FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637120_at:

>probe:Drosophila_2:1637120_at:270:649; Interrogation_Position=108; Antisense; TCAGATGGCCCACTATTACAAGATG
>probe:Drosophila_2:1637120_at:708:663; Interrogation_Position=15; Antisense; TACAGCTTATATACGACCAATTTGC
>probe:Drosophila_2:1637120_at:196:599; Interrogation_Position=152; Antisense; TGTCCCTGCGCCGTGTTAGAAATGA
>probe:Drosophila_2:1637120_at:370:91; Interrogation_Position=176; Antisense; AGTATTGCGGTGTTCCGAGTCTTTC
>probe:Drosophila_2:1637120_at:454:719; Interrogation_Position=188; Antisense; TTCCGAGTCTTTCCATATGTTGCTG
>probe:Drosophila_2:1637120_at:177:681; Interrogation_Position=203; Antisense; TATGTTGCTGGAATCCCGTGCAGTA
>probe:Drosophila_2:1637120_at:618:349; Interrogation_Position=222; Antisense; GCAGTACGCCTGCTTTGGAGATTCA
>probe:Drosophila_2:1637120_at:244:431; Interrogation_Position=305; Antisense; GAGTAACCAACTCCGTGACGGGCAA
>probe:Drosophila_2:1637120_at:99:511; Interrogation_Position=319; Antisense; GTGACGGGCAATTGTGATGGCTACA
>probe:Drosophila_2:1637120_at:522:571; Interrogation_Position=337; Antisense; GGCTACAGCTCATATTTGGATCTCA
>probe:Drosophila_2:1637120_at:190:545; Interrogation_Position=354; Antisense; GGATCTCATGAGCTATATGCCCTGG
>probe:Drosophila_2:1637120_at:600:23; Interrogation_Position=368; Antisense; ATATGCCCTGGCTTTACCAAACCTT
>probe:Drosophila_2:1637120_at:431:713; Interrogation_Position=41; Antisense; TTCTTTTAAATTCCGGCTTGCAGTC
>probe:Drosophila_2:1637120_at:530:349; Interrogation_Position=60; Antisense; GCAGTCCCTTGCAAACAGCATACAG

Paste this into a BLAST search page for me
TCAGATGGCCCACTATTACAAGATGTACAGCTTATATACGACCAATTTGCTGTCCCTGCGCCGTGTTAGAAATGAAGTATTGCGGTGTTCCGAGTCTTTCTTCCGAGTCTTTCCATATGTTGCTGTATGTTGCTGGAATCCCGTGCAGTAGCAGTACGCCTGCTTTGGAGATTCAGAGTAACCAACTCCGTGACGGGCAAGTGACGGGCAATTGTGATGGCTACAGGCTACAGCTCATATTTGGATCTCAGGATCTCATGAGCTATATGCCCTGGATATGCCCTGGCTTTACCAAACCTTTTCTTTTAAATTCCGGCTTGCAGTCGCAGTCCCTTGCAAACAGCATACAG

Full Affymetrix probeset data:

Annotations for 1637120_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720