FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637121_at:

>probe:Drosophila_2:1637121_at:604:399; Interrogation_Position=1012; Antisense; GACATGTGGTCCTCCTATCCGAAGA
>probe:Drosophila_2:1637121_at:584:375; Interrogation_Position=1032; Antisense; GAAGACCGGTATCTACTCGGCCCAG
>probe:Drosophila_2:1637121_at:565:577; Interrogation_Position=1050; Antisense; GGCCCAGGAGTGGACTTCCAGCAAA
>probe:Drosophila_2:1637121_at:677:105; Interrogation_Position=1152; Antisense; AGAACTCCAGGCAGCTACTTTCAAT
>probe:Drosophila_2:1637121_at:336:241; Interrogation_Position=1174; Antisense; AATAACAAGCTGGATTTCGGCGCCC
>probe:Drosophila_2:1637121_at:47:419; Interrogation_Position=1271; Antisense; GAGCTATTAAGAAGTGGCCCACCCA
>probe:Drosophila_2:1637121_at:185:575; Interrogation_Position=1286; Antisense; GGCCCACCCAGGACTATAAGGTCTT
>probe:Drosophila_2:1637121_at:209:497; Interrogation_Position=1306; Antisense; GTCTTCAAGCCAGCTAAATCTCCGA
>probe:Drosophila_2:1637121_at:239:179; Interrogation_Position=1368; Antisense; AACACCACCCTACGGTATCTAAGTG
>probe:Drosophila_2:1637121_at:61:475; Interrogation_Position=1410; Antisense; GTTAAACCCAATTTACTGCCACAGT
>probe:Drosophila_2:1637121_at:29:655; Interrogation_Position=1453; Antisense; TAATTTGCAGGCGATTCCGTTCAAG
>probe:Drosophila_2:1637121_at:125:345; Interrogation_Position=1497; Antisense; GCATACGGGTCCTTTTGAGACTTAA
>probe:Drosophila_2:1637121_at:535:107; Interrogation_Position=947; Antisense; AGAACATGGCTGCTTCGTTGCCGTC
>probe:Drosophila_2:1637121_at:117:103; Interrogation_Position=984; Antisense; AGAGCACTCGCTCAACGGACACGGT

Paste this into a BLAST search page for me
GACATGTGGTCCTCCTATCCGAAGAGAAGACCGGTATCTACTCGGCCCAGGGCCCAGGAGTGGACTTCCAGCAAAAGAACTCCAGGCAGCTACTTTCAATAATAACAAGCTGGATTTCGGCGCCCGAGCTATTAAGAAGTGGCCCACCCAGGCCCACCCAGGACTATAAGGTCTTGTCTTCAAGCCAGCTAAATCTCCGAAACACCACCCTACGGTATCTAAGTGGTTAAACCCAATTTACTGCCACAGTTAATTTGCAGGCGATTCCGTTCAAGGCATACGGGTCCTTTTGAGACTTAAAGAACATGGCTGCTTCGTTGCCGTCAGAGCACTCGCTCAACGGACACGGT

Full Affymetrix probeset data:

Annotations for 1637121_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720