FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637125_at:

>probe:Drosophila_2:1637125_at:647:5; Interrogation_Position=1104; Antisense; ATTGATTTCCAGTTGGCCAGGTGCT
>probe:Drosophila_2:1637125_at:301:609; Interrogation_Position=1147; Antisense; TGAGCTTCTTCATCTATTCCTGCAC
>probe:Drosophila_2:1637125_at:5:9; Interrogation_Position=1162; Antisense; ATTCCTGCACTAGCCAGGAGCTGAG
>probe:Drosophila_2:1637125_at:586:461; Interrogation_Position=1241; Antisense; GATTCAGGATCTCGGTGGCAATGCA
>probe:Drosophila_2:1637125_at:368:233; Interrogation_Position=1260; Antisense; AATGCAGAGTCTATCATCTCCTGGG
>probe:Drosophila_2:1637125_at:224:37; Interrogation_Position=1272; Antisense; ATCATCTCCTGGGAATCACTGCAAG
>probe:Drosophila_2:1637125_at:119:193; Interrogation_Position=1308; Antisense; AACTTTGGTCGCTTTGGTTGCGGCA
>probe:Drosophila_2:1637125_at:319:623; Interrogation_Position=1326; Antisense; TGCGGCATGGGCATCGAATCGCTGC
>probe:Drosophila_2:1637125_at:719:79; Interrogation_Position=1375; Antisense; AGGTGGCCGATCTGGATGGAATCAA
>probe:Drosophila_2:1637125_at:184:77; Interrogation_Position=1399; Antisense; AGGAGAACGCCATTCTCACCGACAT
>probe:Drosophila_2:1637125_at:224:585; Interrogation_Position=1425; Antisense; TGGAATATCACACCCTTCAAGGAGT
>probe:Drosophila_2:1637125_at:240:225; Interrogation_Position=1443; Antisense; AAGGAGTCCGCCAAGCAGCAGCGAC
>probe:Drosophila_2:1637125_at:436:605; Interrogation_Position=1472; Antisense; TGATATCTTCAAGCACGCCATCGAT
>probe:Drosophila_2:1637125_at:316:539; Interrogation_Position=1557; Antisense; GGTATTTCGTAATTGTAACCCATAT

Paste this into a BLAST search page for me
ATTGATTTCCAGTTGGCCAGGTGCTTGAGCTTCTTCATCTATTCCTGCACATTCCTGCACTAGCCAGGAGCTGAGGATTCAGGATCTCGGTGGCAATGCAAATGCAGAGTCTATCATCTCCTGGGATCATCTCCTGGGAATCACTGCAAGAACTTTGGTCGCTTTGGTTGCGGCATGCGGCATGGGCATCGAATCGCTGCAGGTGGCCGATCTGGATGGAATCAAAGGAGAACGCCATTCTCACCGACATTGGAATATCACACCCTTCAAGGAGTAAGGAGTCCGCCAAGCAGCAGCGACTGATATCTTCAAGCACGCCATCGATGGTATTTCGTAATTGTAACCCATAT

Full Affymetrix probeset data:

Annotations for 1637125_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720