FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637126_at:

>probe:Drosophila_2:1637126_at:209:615; Interrogation_Position=1041; Antisense; TGAATCCAAGGATGGCCCCAGCTAT
>probe:Drosophila_2:1637126_at:647:581; Interrogation_Position=1053; Antisense; TGGCCCCAGCTATATTCATTCGGAA
>probe:Drosophila_2:1637126_at:475:377; Interrogation_Position=1075; Antisense; GAAGCAGCTTTATCCTACAGACAGT
>probe:Drosophila_2:1637126_at:684:105; Interrogation_Position=1093; Antisense; AGACAGTCCTTGAACCAGCAGGCTG
>probe:Drosophila_2:1637126_at:166:545; Interrogation_Position=1128; Antisense; GGATCGCCTAAACGCCGGAAATGAA
>probe:Drosophila_2:1637126_at:236:699; Interrogation_Position=1156; Antisense; TTTAGGCGTTACAACTCCGTGGCAC
>probe:Drosophila_2:1637126_at:129:291; Interrogation_Position=1173; Antisense; CGTGGCACGGAATCACTCGATCAAA
>probe:Drosophila_2:1637126_at:667:609; Interrogation_Position=1229; Antisense; TGACATTTTGGTTCAGCGATGCTGT
>probe:Drosophila_2:1637126_at:168:121; Interrogation_Position=1243; Antisense; AGCGATGCTGTACTTTCCTAGAAAC
>probe:Drosophila_2:1637126_at:494:207; Interrogation_Position=773; Antisense; AAGCTTCCTCTACCACAATGAAATC
>probe:Drosophila_2:1637126_at:578:199; Interrogation_Position=828; Antisense; AACGCAGCGCTCCTTCAAATTAAAT
>probe:Drosophila_2:1637126_at:14:665; Interrogation_Position=848; Antisense; TAAATCCTGCTGACTCAGACTCGAA
>probe:Drosophila_2:1637126_at:150:93; Interrogation_Position=937; Antisense; AGTTCTCAAGAACAAGCCCCGTCTG
>probe:Drosophila_2:1637126_at:615:367; Interrogation_Position=996; Antisense; GAATGATCGTGTCCCTTCAAAGACC

Paste this into a BLAST search page for me
TGAATCCAAGGATGGCCCCAGCTATTGGCCCCAGCTATATTCATTCGGAAGAAGCAGCTTTATCCTACAGACAGTAGACAGTCCTTGAACCAGCAGGCTGGGATCGCCTAAACGCCGGAAATGAATTTAGGCGTTACAACTCCGTGGCACCGTGGCACGGAATCACTCGATCAAATGACATTTTGGTTCAGCGATGCTGTAGCGATGCTGTACTTTCCTAGAAACAAGCTTCCTCTACCACAATGAAATCAACGCAGCGCTCCTTCAAATTAAATTAAATCCTGCTGACTCAGACTCGAAAGTTCTCAAGAACAAGCCCCGTCTGGAATGATCGTGTCCCTTCAAAGACC

Full Affymetrix probeset data:

Annotations for 1637126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720