FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637127_at:

>probe:Drosophila_2:1637127_at:376:581; Interrogation_Position=1998; Antisense; TGGCGGCCAAGAGATGTCACAATCA
>probe:Drosophila_2:1637127_at:83:495; Interrogation_Position=2013; Antisense; GTCACAATCACTATCTGGTCATGGA
>probe:Drosophila_2:1637127_at:196:55; Interrogation_Position=2060; Antisense; ATGAATCTGTTCACCTCCAAGATGC
>probe:Drosophila_2:1637127_at:98:261; Interrogation_Position=2102; Antisense; CACGAACCGGGTAGCATTCTCAATG
>probe:Drosophila_2:1637127_at:432:551; Interrogation_Position=2155; Antisense; GGAGATCCGTAATTTCTGGCGCCAG
>probe:Drosophila_2:1637127_at:472:141; Interrogation_Position=2224; Antisense; ACTGGAGCACGGACTGAATCACTAC
>probe:Drosophila_2:1637127_at:661:365; Interrogation_Position=2239; Antisense; GAATCACTACGTTGAGGTGCTCAAG
>probe:Drosophila_2:1637127_at:378:447; Interrogation_Position=2279; Antisense; GATGCGGAAGTCGTCTTTCTGCGTC
>probe:Drosophila_2:1637127_at:380:177; Interrogation_Position=2308; Antisense; AAACGAAGAGTTGCGCCATCTGCTG
>probe:Drosophila_2:1637127_at:97:689; Interrogation_Position=2360; Antisense; TATTCAATTACAGCCTCAACCGCAA
>probe:Drosophila_2:1637127_at:557:13; Interrogation_Position=2407; Antisense; ATTATTGTCCGATTTCACTGCAAAC
>probe:Drosophila_2:1637127_at:628:31; Interrogation_Position=2442; Antisense; ATAATTGTGCCTAGGTCTTGCTCTT
>probe:Drosophila_2:1637127_at:41:647; Interrogation_Position=2457; Antisense; TCTTGCTCTTTGACATTGACATCGA
>probe:Drosophila_2:1637127_at:644:355; Interrogation_Position=2507; Antisense; GCACGGGCGCCATCTGAAAAAGCTT

Paste this into a BLAST search page for me
TGGCGGCCAAGAGATGTCACAATCAGTCACAATCACTATCTGGTCATGGAATGAATCTGTTCACCTCCAAGATGCCACGAACCGGGTAGCATTCTCAATGGGAGATCCGTAATTTCTGGCGCCAGACTGGAGCACGGACTGAATCACTACGAATCACTACGTTGAGGTGCTCAAGGATGCGGAAGTCGTCTTTCTGCGTCAAACGAAGAGTTGCGCCATCTGCTGTATTCAATTACAGCCTCAACCGCAAATTATTGTCCGATTTCACTGCAAACATAATTGTGCCTAGGTCTTGCTCTTTCTTGCTCTTTGACATTGACATCGAGCACGGGCGCCATCTGAAAAAGCTT

Full Affymetrix probeset data:

Annotations for 1637127_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720