FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637129_at:

>probe:Drosophila_2:1637129_at:121:507; Interrogation_Position=215; Antisense; GTGCCCGCTCTGGATGATAATGGTT
>probe:Drosophila_2:1637129_at:453:229; Interrogation_Position=233; Antisense; AATGGTTTCTATTTGGCCGACAGCC
>probe:Drosophila_2:1637129_at:206:271; Interrogation_Position=257; Antisense; CATGCTATTAACTCCTACCTGGTGA
>probe:Drosophila_2:1637129_at:357:563; Interrogation_Position=294; Antisense; GGAATGATTCTCTATACCCCAAGGA
>probe:Drosophila_2:1637129_at:335:205; Interrogation_Position=326; Antisense; AAGCGAGCCATTGTCGATCAGCGTC
>probe:Drosophila_2:1637129_at:613:623; Interrogation_Position=448; Antisense; TGCCCTGGAGGGTGTCTACAAGTCC
>probe:Drosophila_2:1637129_at:454:217; Interrogation_Position=467; Antisense; AAGTCCCTCAATCTGTTTCTGGAGA
>probe:Drosophila_2:1637129_at:341:67; Interrogation_Position=492; Antisense; ATGGCAATTATCTGGCCGGCGACAA
>probe:Drosophila_2:1637129_at:601:43; Interrogation_Position=542; Antisense; ATCGCCGGCTTGACAGGATTTTTCG
>probe:Drosophila_2:1637129_at:96:17; Interrogation_Position=559; Antisense; ATTTTTCGTGTTCCTGCCTGTAGAT
>probe:Drosophila_2:1637129_at:2:99; Interrogation_Position=580; Antisense; AGATGCCACTAAGTATCCCGAGCTG
>probe:Drosophila_2:1637129_at:402:583; Interrogation_Position=603; Antisense; TGGCTGCCTGGATCAAGCGCATCAA
>probe:Drosophila_2:1637129_at:566:249; Interrogation_Position=625; Antisense; CAAGGAGCTGCCATACTACGAGGAA
>probe:Drosophila_2:1637129_at:495:507; Interrogation_Position=663; Antisense; GTGCTGCCCAAATCATCGAGTTCAT

Paste this into a BLAST search page for me
GTGCCCGCTCTGGATGATAATGGTTAATGGTTTCTATTTGGCCGACAGCCCATGCTATTAACTCCTACCTGGTGAGGAATGATTCTCTATACCCCAAGGAAAGCGAGCCATTGTCGATCAGCGTCTGCCCTGGAGGGTGTCTACAAGTCCAAGTCCCTCAATCTGTTTCTGGAGAATGGCAATTATCTGGCCGGCGACAAATCGCCGGCTTGACAGGATTTTTCGATTTTTCGTGTTCCTGCCTGTAGATAGATGCCACTAAGTATCCCGAGCTGTGGCTGCCTGGATCAAGCGCATCAACAAGGAGCTGCCATACTACGAGGAAGTGCTGCCCAAATCATCGAGTTCAT

Full Affymetrix probeset data:

Annotations for 1637129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720