FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637130_at:

>probe:Drosophila_2:1637130_at:51:489; Interrogation_Position=1040; Antisense; GTACGTGATCGTGTGCTAATTTCCA
>probe:Drosophila_2:1637130_at:288:19; Interrogation_Position=1058; Antisense; ATTTCCACACCCAGTAGAGCCAAGA
>probe:Drosophila_2:1637130_at:450:415; Interrogation_Position=1074; Antisense; GAGCCAAGAACGTCAGCATTTTTTA
>probe:Drosophila_2:1637130_at:726:323; Interrogation_Position=1112; Antisense; GCGAAATGTTTTTACCACGGATGAC
>probe:Drosophila_2:1637130_at:407:141; Interrogation_Position=1128; Antisense; ACGGATGACATCAGTGCGTGTGCCT
>probe:Drosophila_2:1637130_at:155:599; Interrogation_Position=1158; Antisense; TGTACGTGTGCGTGTTTCCCAAATA
>probe:Drosophila_2:1637130_at:43:419; Interrogation_Position=725; Antisense; GAGCTAGTGCGCTGATTGCGATCTC
>probe:Drosophila_2:1637130_at:79:637; Interrogation_Position=762; Antisense; TCGATGCTATTTACAGGGCTACCTA
>probe:Drosophila_2:1637130_at:403:675; Interrogation_Position=785; Antisense; TAGCTCGCCACCATTAACTTAGTTC
>probe:Drosophila_2:1637130_at:609:659; Interrogation_Position=799; Antisense; TAACTTAGTTCCATGGCCAGCTACT
>probe:Drosophila_2:1637130_at:615:579; Interrogation_Position=813; Antisense; GGCCAGCTACTCTCTATATTTTTAT
>probe:Drosophila_2:1637130_at:135:13; Interrogation_Position=836; Antisense; ATTATGCCTGTTTACTAGCTTGTGC
>probe:Drosophila_2:1637130_at:517:515; Interrogation_Position=865; Antisense; GTGTCTTAGTGTTGCTTGCTATCTA
>probe:Drosophila_2:1637130_at:576:475; Interrogation_Position=936; Antisense; GTTTACAAACCCTCGAGCACAAGTA

Paste this into a BLAST search page for me
GTACGTGATCGTGTGCTAATTTCCAATTTCCACACCCAGTAGAGCCAAGAGAGCCAAGAACGTCAGCATTTTTTAGCGAAATGTTTTTACCACGGATGACACGGATGACATCAGTGCGTGTGCCTTGTACGTGTGCGTGTTTCCCAAATAGAGCTAGTGCGCTGATTGCGATCTCTCGATGCTATTTACAGGGCTACCTATAGCTCGCCACCATTAACTTAGTTCTAACTTAGTTCCATGGCCAGCTACTGGCCAGCTACTCTCTATATTTTTATATTATGCCTGTTTACTAGCTTGTGCGTGTCTTAGTGTTGCTTGCTATCTAGTTTACAAACCCTCGAGCACAAGTA

Full Affymetrix probeset data:

Annotations for 1637130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720