FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637134_at:

>probe:Drosophila_2:1637134_at:21:487; Interrogation_Position=1013; Antisense; GTCGGCCACCGATTCGAAAGTTACT
>probe:Drosophila_2:1637134_at:275:635; Interrogation_Position=1094; Antisense; TCGCCGTGGGACTACCAATTTTTGT
>probe:Drosophila_2:1637134_at:404:617; Interrogation_Position=586; Antisense; TGCATCTCAAACATTACCCTGGACA
>probe:Drosophila_2:1637134_at:622:527; Interrogation_Position=615; Antisense; GGGTTGCTATTTCCTGTTCCATATC
>probe:Drosophila_2:1637134_at:90:23; Interrogation_Position=635; Antisense; ATATCTCTCTTTTGTACCGACTGCT
>probe:Drosophila_2:1637134_at:235:145; Interrogation_Position=654; Antisense; ACTGCTTGGTCTGCGATTGAGGGAA
>probe:Drosophila_2:1637134_at:678:127; Interrogation_Position=700; Antisense; ACCATTTTTGGCCAGCAGTTGCGTG
>probe:Drosophila_2:1637134_at:362:543; Interrogation_Position=746; Antisense; GGATTAGAAGCCTAACCCTGACCTG
>probe:Drosophila_2:1637134_at:321:111; Interrogation_Position=775; Antisense; AGAATCGTATCTCCCTATATCCTAT
>probe:Drosophila_2:1637134_at:518:625; Interrogation_Position=816; Antisense; TGCCCTGATCATCTGCTTTAGTGGA
>probe:Drosophila_2:1637134_at:164:277; Interrogation_Position=831; Antisense; CTTTAGTGGATACCGCTTGCAGCAT
>probe:Drosophila_2:1637134_at:711:653; Interrogation_Position=870; Antisense; TAATCCCGGCCAGTTTATATCCATG
>probe:Drosophila_2:1637134_at:705:697; Interrogation_Position=926; Antisense; TTTACTTGCCCTGCTACTATGGAAA
>probe:Drosophila_2:1637134_at:588:625; Interrogation_Position=966; Antisense; TGCCAATCAGCTGACCAACGAGGTT

Paste this into a BLAST search page for me
GTCGGCCACCGATTCGAAAGTTACTTCGCCGTGGGACTACCAATTTTTGTTGCATCTCAAACATTACCCTGGACAGGGTTGCTATTTCCTGTTCCATATCATATCTCTCTTTTGTACCGACTGCTACTGCTTGGTCTGCGATTGAGGGAAACCATTTTTGGCCAGCAGTTGCGTGGGATTAGAAGCCTAACCCTGACCTGAGAATCGTATCTCCCTATATCCTATTGCCCTGATCATCTGCTTTAGTGGACTTTAGTGGATACCGCTTGCAGCATTAATCCCGGCCAGTTTATATCCATGTTTACTTGCCCTGCTACTATGGAAATGCCAATCAGCTGACCAACGAGGTT

Full Affymetrix probeset data:

Annotations for 1637134_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720