FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637135_at:

>probe:Drosophila_2:1637135_at:180:653; Interrogation_Position=149; Antisense; TAAAAAAGCGCAGGGCCGAAGTCGA
>probe:Drosophila_2:1637135_at:3:213; Interrogation_Position=182; Antisense; AAGAGGTACTGGTCAAGCGGACGCA
>probe:Drosophila_2:1637135_at:171:725; Interrogation_Position=265; Antisense; TTGTCTGCTGGCCAAAGCGCCAGTG
>probe:Drosophila_2:1637135_at:462:397; Interrogation_Position=295; Antisense; GACAACGATCTCAACGGCGCCGCAA
>probe:Drosophila_2:1637135_at:193:593; Interrogation_Position=331; Antisense; TGGTGGCTGCGCGATCCTCCAGGAT
>probe:Drosophila_2:1637135_at:635:25; Interrogation_Position=420; Antisense; ATCAGCGGGCACAGGTCCGACGACG
>probe:Drosophila_2:1637135_at:460:293; Interrogation_Position=440; Antisense; CGACGTGGTGGTGGTCAGCTCCATC
>probe:Drosophila_2:1637135_at:612:269; Interrogation_Position=461; Antisense; CATCCGTTGACGTTGCGGTGACGAT
>probe:Drosophila_2:1637135_at:447:27; Interrogation_Position=484; Antisense; ATAGCGCCGGCTACGTTGTTGCTGT
>probe:Drosophila_2:1637135_at:171:727; Interrogation_Position=499; Antisense; TTGTTGCTGTCGTTGCAGCGGCAAT
>probe:Drosophila_2:1637135_at:231:189; Interrogation_Position=573; Antisense; AACAGAAGCCACATCCTTAGCAATA
>probe:Drosophila_2:1637135_at:406:553; Interrogation_Position=604; Antisense; GGAGCAGCAGCGTTAATATCATCAT
>probe:Drosophila_2:1637135_at:439:657; Interrogation_Position=629; Antisense; TAAGTGCAAGCATCGCCAACATCAT
>probe:Drosophila_2:1637135_at:447:151; Interrogation_Position=659; Antisense; ACAAGATCCCAAAACACCAATACCA

Paste this into a BLAST search page for me
TAAAAAAGCGCAGGGCCGAAGTCGAAAGAGGTACTGGTCAAGCGGACGCATTGTCTGCTGGCCAAAGCGCCAGTGGACAACGATCTCAACGGCGCCGCAATGGTGGCTGCGCGATCCTCCAGGATATCAGCGGGCACAGGTCCGACGACGCGACGTGGTGGTGGTCAGCTCCATCCATCCGTTGACGTTGCGGTGACGATATAGCGCCGGCTACGTTGTTGCTGTTTGTTGCTGTCGTTGCAGCGGCAATAACAGAAGCCACATCCTTAGCAATAGGAGCAGCAGCGTTAATATCATCATTAAGTGCAAGCATCGCCAACATCATACAAGATCCCAAAACACCAATACCA

Full Affymetrix probeset data:

Annotations for 1637135_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720