Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637136_at:

>probe:Drosophila_2:1637136_at:120:435; Interrogation_Position=1828; Antisense; GAGGGCCCTGCAATAGTTCTGGATG
>probe:Drosophila_2:1637136_at:94:51; Interrogation_Position=1856; Antisense; ATGCCGACTTTTTGGACATCACACT
>probe:Drosophila_2:1637136_at:286:207; Interrogation_Position=1909; Antisense; AAGTTGATGGCAGCGGCACTCACTA
>probe:Drosophila_2:1637136_at:187:283; Interrogation_Position=1950; Antisense; CTCCATCAGCCCCAATATTAGTTTA
>probe:Drosophila_2:1637136_at:447:471; Interrogation_Position=1982; Antisense; GTTCGCCCATAGAGCCGAGTAGTCT
>probe:Drosophila_2:1637136_at:285:123; Interrogation_Position=2015; Antisense; AGCCCAATGTTATCTTTACTCGTCG
>probe:Drosophila_2:1637136_at:724:705; Interrogation_Position=2030; Antisense; TTACTCGTCGCTCGGAGGTGATCAA
>probe:Drosophila_2:1637136_at:28:329; Interrogation_Position=2084; Antisense; GCGTTGCCCTGCTTGCAGAGAAATT
>probe:Drosophila_2:1637136_at:385:421; Interrogation_Position=2101; Antisense; GAGAAATTCCTCCAAAGCTTTAGCG
>probe:Drosophila_2:1637136_at:721:171; Interrogation_Position=2114; Antisense; AAAGCTTTAGCGAATCTGCCCCTAA
>probe:Drosophila_2:1637136_at:355:703; Interrogation_Position=2142; Antisense; TTATGGATGGAAGCCCTCTAAACAG
>probe:Drosophila_2:1637136_at:515:281; Interrogation_Position=2175; Antisense; CTCTGCAGTCTCTATTTCACATTTG
>probe:Drosophila_2:1637136_at:618:495; Interrogation_Position=2255; Antisense; GTCAGCTGCTGTCCGTGGAATTCAA
>probe:Drosophila_2:1637136_at:382:563; Interrogation_Position=2384; Antisense; GGAATTCGTTGACCGCCTATGGAAG

Paste this into a BLAST search page for me
GAGGGCCCTGCAATAGTTCTGGATGATGCCGACTTTTTGGACATCACACTAAGTTGATGGCAGCGGCACTCACTACTCCATCAGCCCCAATATTAGTTTAGTTCGCCCATAGAGCCGAGTAGTCTAGCCCAATGTTATCTTTACTCGTCGTTACTCGTCGCTCGGAGGTGATCAAGCGTTGCCCTGCTTGCAGAGAAATTGAGAAATTCCTCCAAAGCTTTAGCGAAAGCTTTAGCGAATCTGCCCCTAATTATGGATGGAAGCCCTCTAAACAGCTCTGCAGTCTCTATTTCACATTTGGTCAGCTGCTGTCCGTGGAATTCAAGGAATTCGTTGACCGCCTATGGAAG

Full Affymetrix probeset data:

Annotations for 1637136_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime