Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637138_at:

>probe:Drosophila_2:1637138_at:7:111; Interrogation_Position=150; Antisense; AGAAGTGATGCGCACTCTCGGCCAG
>probe:Drosophila_2:1637138_at:322:313; Interrogation_Position=170; Antisense; GCCAGAATCACACCGAGTCGGAAAT
>probe:Drosophila_2:1637138_at:523:237; Interrogation_Position=192; Antisense; AATCTACAGATATTCCGAGGGACTC
>probe:Drosophila_2:1637138_at:391:531; Interrogation_Position=232; Antisense; GGGTACATACAACTCACTGATTTCA
>probe:Drosophila_2:1637138_at:49:239; Interrogation_Position=273; Antisense; AATCTACAGCGCGATGGGCAGCAGT
>probe:Drosophila_2:1637138_at:653:349; Interrogation_Position=290; Antisense; GCAGCAGTGACTATTTGAAGGCAGC
>probe:Drosophila_2:1637138_at:656:149; Interrogation_Position=352; Antisense; ACATATGGCGAGCTACGTCACGTTT
>probe:Drosophila_2:1637138_at:498:493; Interrogation_Position=368; Antisense; GTCACGTTTTCATCAATCTTGGCGA
>probe:Drosophila_2:1637138_at:43:251; Interrogation_Position=414; Antisense; CAATGAAGTGTTTCGTCAGGCTGAT
>probe:Drosophila_2:1637138_at:77:441; Interrogation_Position=442; Antisense; GATGGCGATGGCGTTATTAACTTCC
>probe:Drosophila_2:1637138_at:34:149; Interrogation_Position=461; Antisense; ACTTCCGTGATTTTTGTACAGCCTA
>probe:Drosophila_2:1637138_at:463:3; Interrogation_Position=60; Antisense; ATTGGCGAATGACGATCTTCAAGAC
>probe:Drosophila_2:1637138_at:122:401; Interrogation_Position=82; Antisense; GACATTTGCGAAGCCTTCGAGCTCT
>probe:Drosophila_2:1637138_at:489:637; Interrogation_Position=98; Antisense; TCGAGCTCTGTGATCCTGAGAAGAC

Paste this into a BLAST search page for me
AGAAGTGATGCGCACTCTCGGCCAGGCCAGAATCACACCGAGTCGGAAATAATCTACAGATATTCCGAGGGACTCGGGTACATACAACTCACTGATTTCAAATCTACAGCGCGATGGGCAGCAGTGCAGCAGTGACTATTTGAAGGCAGCACATATGGCGAGCTACGTCACGTTTGTCACGTTTTCATCAATCTTGGCGACAATGAAGTGTTTCGTCAGGCTGATGATGGCGATGGCGTTATTAACTTCCACTTCCGTGATTTTTGTACAGCCTAATTGGCGAATGACGATCTTCAAGACGACATTTGCGAAGCCTTCGAGCTCTTCGAGCTCTGTGATCCTGAGAAGAC

Full Affymetrix probeset data:

Annotations for 1637138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime