Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637139_at:

>probe:Drosophila_2:1637139_at:381:119; Interrogation_Position=1138; Antisense; AGCTGCCGCTCGACTTGAATCGGGA
>probe:Drosophila_2:1637139_at:201:207; Interrogation_Position=1162; Antisense; AAGCTGTCGAGGATTCGCGCTACAA
>probe:Drosophila_2:1637139_at:550:489; Interrogation_Position=1200; Antisense; TACCAAAAGTTTGCCAAGCCGCCAT
>probe:Drosophila_2:1637139_at:282:125; Interrogation_Position=1216; Antisense; AGCCGCCATTTGATCTGTCGGAAAT
>probe:Drosophila_2:1637139_at:198:251; Interrogation_Position=1244; Antisense; CAAGTTCTCAGTCAGCAAGGCGGCT
>probe:Drosophila_2:1637139_at:584:55; Interrogation_Position=1273; Antisense; ATGAGGACAACGATTCGCGCTTCTC
>probe:Drosophila_2:1637139_at:653:207; Interrogation_Position=1343; Antisense; AATGGAAGGTGAGCGATCGCCCGTC
>probe:Drosophila_2:1637139_at:614:451; Interrogation_Position=1410; Antisense; GATCTGAGTGGCACATCCTCGGGCG
>probe:Drosophila_2:1637139_at:639:45; Interrogation_Position=1424; Antisense; ATCCTCGGGCGCAGCTCTAAGTGGA
>probe:Drosophila_2:1637139_at:321:657; Interrogation_Position=1441; Antisense; TAAGTGGAGTCCAGGTCATCTCCGC
>probe:Drosophila_2:1637139_at:512:559; Interrogation_Position=1472; Antisense; GGACAACATTATCGCGGTGGCCAAT
>probe:Drosophila_2:1637139_at:574:85; Interrogation_Position=1512; Antisense; AGTCCCGCTTTGAACGAGGTGCTCG
>probe:Drosophila_2:1637139_at:125:621; Interrogation_Position=1531; Antisense; TGCTCGCGCTCAAGAGGAGTGCTGC
>probe:Drosophila_2:1637139_at:189:433; Interrogation_Position=1547; Antisense; GAGTGCTGCTTCACCAGAGACTTAG

Paste this into a BLAST search page for me
AGCTGCCGCTCGACTTGAATCGGGAAAGCTGTCGAGGATTCGCGCTACAATACCAAAAGTTTGCCAAGCCGCCATAGCCGCCATTTGATCTGTCGGAAATCAAGTTCTCAGTCAGCAAGGCGGCTATGAGGACAACGATTCGCGCTTCTCAATGGAAGGTGAGCGATCGCCCGTCGATCTGAGTGGCACATCCTCGGGCGATCCTCGGGCGCAGCTCTAAGTGGATAAGTGGAGTCCAGGTCATCTCCGCGGACAACATTATCGCGGTGGCCAATAGTCCCGCTTTGAACGAGGTGCTCGTGCTCGCGCTCAAGAGGAGTGCTGCGAGTGCTGCTTCACCAGAGACTTAG

Full Affymetrix probeset data:

Annotations for 1637139_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime