FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637141_at:

>probe:Drosophila_2:1637141_at:395:235; Interrogation_Position=2683; Antisense; AATCCAGTCTGATGCATACGCTTGC
>probe:Drosophila_2:1637141_at:70:29; Interrogation_Position=2698; Antisense; ATACGCTTGCTCATTGATTAGACGG
>probe:Drosophila_2:1637141_at:292:407; Interrogation_Position=2718; Antisense; GACGGACTAAGATGCCACTGTTTGA
>probe:Drosophila_2:1637141_at:17:603; Interrogation_Position=2736; Antisense; TGTTTGATCAATTTAAGCGCGCCTA
>probe:Drosophila_2:1637141_at:408:203; Interrogation_Position=2750; Antisense; AAGCGCGCCTATGCCGAAATTTTAT
>probe:Drosophila_2:1637141_at:43:585; Interrogation_Position=2780; Antisense; TGGCAGTTGCTTTCGAAGCGGGCTT
>probe:Drosophila_2:1637141_at:243:693; Interrogation_Position=2803; Antisense; TTTGATCCTCAAGCACACGCAGAAT
>probe:Drosophila_2:1637141_at:281:373; Interrogation_Position=2872; Antisense; GAAGTGTGCCAAGCCCAAACGGACG
>probe:Drosophila_2:1637141_at:149:315; Interrogation_Position=2988; Antisense; GCCATGGCGGTCACATTGATCACAT
>probe:Drosophila_2:1637141_at:640:161; Interrogation_Position=3033; Antisense; ACAATGTCTGTGCTACGTGTGGCTG
>probe:Drosophila_2:1637141_at:666:727; Interrogation_Position=3065; Antisense; TTGGAGCGCACCTCAGAGCTGCTAG
>probe:Drosophila_2:1637141_at:536:263; Interrogation_Position=3106; Antisense; CAGACCTTGAGTGATGTGCATTCCT
>probe:Drosophila_2:1637141_at:465:273; Interrogation_Position=3147; Antisense; CTTAACTTTCTTTCGTCTGTGTGGA
>probe:Drosophila_2:1637141_at:191:25; Interrogation_Position=3244; Antisense; ATATGACCACTTACTAGCCAAGCTA

Paste this into a BLAST search page for me
AATCCAGTCTGATGCATACGCTTGCATACGCTTGCTCATTGATTAGACGGGACGGACTAAGATGCCACTGTTTGATGTTTGATCAATTTAAGCGCGCCTAAAGCGCGCCTATGCCGAAATTTTATTGGCAGTTGCTTTCGAAGCGGGCTTTTTGATCCTCAAGCACACGCAGAATGAAGTGTGCCAAGCCCAAACGGACGGCCATGGCGGTCACATTGATCACATACAATGTCTGTGCTACGTGTGGCTGTTGGAGCGCACCTCAGAGCTGCTAGCAGACCTTGAGTGATGTGCATTCCTCTTAACTTTCTTTCGTCTGTGTGGAATATGACCACTTACTAGCCAAGCTA

Full Affymetrix probeset data:

Annotations for 1637141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720