FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637143_at:

>probe:Drosophila_2:1637143_at:422:475; Interrogation_Position=328; Antisense; GTTTGACGAAAGTGCCCAATGGCGA
>probe:Drosophila_2:1637143_at:73:325; Interrogation_Position=349; Antisense; GCGAACGATCGACTGGCTGCTTAAC
>probe:Drosophila_2:1637143_at:698:523; Interrogation_Position=415; Antisense; GGGCTGCGGCAATGGCATGTTCCTA
>probe:Drosophila_2:1637143_at:165:347; Interrogation_Position=429; Antisense; GCATGTTCCTAGTGGGCCTGGCAAA
>probe:Drosophila_2:1637143_at:144:55; Interrogation_Position=453; Antisense; ATGAAGGCTTCACCGGAGACCTGAC
>probe:Drosophila_2:1637143_at:426:173; Interrogation_Position=497; Antisense; AAAGCCGTCGAGCTGGCGCAAAACA
>probe:Drosophila_2:1637143_at:310:555; Interrogation_Position=562; Antisense; GGACTTAACCCAGCCGCAGAACGAG
>probe:Drosophila_2:1637143_at:616:119; Interrogation_Position=585; Antisense; AGCTGGGCCAATTTGACGTGGTGCA
>probe:Drosophila_2:1637143_at:175:563; Interrogation_Position=617; Antisense; GGAACCTACGATGCAGTCAGTCTTT
>probe:Drosophila_2:1637143_at:254:497; Interrogation_Position=632; Antisense; GTCAGTCTTTGTCCGGATAATGCCA
>probe:Drosophila_2:1637143_at:379:75; Interrogation_Position=657; Antisense; AGGAGAAACGTGCTCTCTACCTGGA
>probe:Drosophila_2:1637143_at:270:183; Interrogation_Position=690; Antisense; AAAAGTTGCTGCGAACTGCTGACAG
>probe:Drosophila_2:1637143_at:175:127; Interrogation_Position=713; Antisense; AGCCTGTTTGTAATCACGTCGTGCA
>probe:Drosophila_2:1637143_at:597:599; Interrogation_Position=781; Antisense; TGTCAAGTACTATACCATTCCCACG

Paste this into a BLAST search page for me
GTTTGACGAAAGTGCCCAATGGCGAGCGAACGATCGACTGGCTGCTTAACGGGCTGCGGCAATGGCATGTTCCTAGCATGTTCCTAGTGGGCCTGGCAAAATGAAGGCTTCACCGGAGACCTGACAAAGCCGTCGAGCTGGCGCAAAACAGGACTTAACCCAGCCGCAGAACGAGAGCTGGGCCAATTTGACGTGGTGCAGGAACCTACGATGCAGTCAGTCTTTGTCAGTCTTTGTCCGGATAATGCCAAGGAGAAACGTGCTCTCTACCTGGAAAAAGTTGCTGCGAACTGCTGACAGAGCCTGTTTGTAATCACGTCGTGCATGTCAAGTACTATACCATTCCCACG

Full Affymetrix probeset data:

Annotations for 1637143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720