FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637145_at:

>probe:Drosophila_2:1637145_at:709:489; Interrogation_Position=331; Antisense; GTACATCCATGAGAAGGCGGCCAAT
>probe:Drosophila_2:1637145_at:88:581; Interrogation_Position=349; Antisense; GGCCAATTTTGTGATGCGCTCGCTG
>probe:Drosophila_2:1637145_at:325:211; Interrogation_Position=377; Antisense; AAGAAGCTGCTTGTGCACCGCAAAC
>probe:Drosophila_2:1637145_at:275:131; Interrogation_Position=393; Antisense; ACCGCAAACTCCTAGTGGCTTTTGT
>probe:Drosophila_2:1637145_at:316:609; Interrogation_Position=444; Antisense; TGAGCGTGTGCAGCCTGTGCGATCT
>probe:Drosophila_2:1637145_at:207:293; Interrogation_Position=463; Antisense; CGATCTGGTCTTCGCAACGGAGTTA
>probe:Drosophila_2:1637145_at:196:195; Interrogation_Position=478; Antisense; AACGGAGTTATCTGCCTTTGTGCCC
>probe:Drosophila_2:1637145_at:721:287; Interrogation_Position=565; Antisense; CTGGCTGCTTCGTCTGGGCGATCAA
>probe:Drosophila_2:1637145_at:519:523; Interrogation_Position=580; Antisense; GGGCGATCAAGCGAGCTCCAGCATT
>probe:Drosophila_2:1637145_at:414:7; Interrogation_Position=602; Antisense; ATTGCCCTCCAGTGTGGCCTTGTGG
>probe:Drosophila_2:1637145_at:179:103; Interrogation_Position=640; Antisense; AGAGCCGCAGGAGTTTTGGCACCGC
>probe:Drosophila_2:1637145_at:509:501; Interrogation_Position=665; Antisense; GTCGACCAATACTTGCGCTTGCCTT
>probe:Drosophila_2:1637145_at:388:97; Interrogation_Position=803; Antisense; AGATCCTCGCTGTAGGGTTGCGCTT
>probe:Drosophila_2:1637145_at:20:325; Interrogation_Position=822; Antisense; GCGCTTCCAGATCCGTTGAATCGAT

Paste this into a BLAST search page for me
GTACATCCATGAGAAGGCGGCCAATGGCCAATTTTGTGATGCGCTCGCTGAAGAAGCTGCTTGTGCACCGCAAACACCGCAAACTCCTAGTGGCTTTTGTTGAGCGTGTGCAGCCTGTGCGATCTCGATCTGGTCTTCGCAACGGAGTTAAACGGAGTTATCTGCCTTTGTGCCCCTGGCTGCTTCGTCTGGGCGATCAAGGGCGATCAAGCGAGCTCCAGCATTATTGCCCTCCAGTGTGGCCTTGTGGAGAGCCGCAGGAGTTTTGGCACCGCGTCGACCAATACTTGCGCTTGCCTTAGATCCTCGCTGTAGGGTTGCGCTTGCGCTTCCAGATCCGTTGAATCGAT

Full Affymetrix probeset data:

Annotations for 1637145_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720