Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637148_at:

>probe:Drosophila_2:1637148_at:247:657; Interrogation_Position=3770; Antisense; TAATGTTTTCTCCAATTCCTCTAGC
>probe:Drosophila_2:1637148_at:619:271; Interrogation_Position=3788; Antisense; CTCTAGCTTGTACACTTTTTTCCTG
>probe:Drosophila_2:1637148_at:653:699; Interrogation_Position=3803; Antisense; TTTTTTCCTGTAAAGCCTCTTCTGC
>probe:Drosophila_2:1637148_at:81:175; Interrogation_Position=3814; Antisense; AAAGCCTCTTCTGCTTTAGTGCGTC
>probe:Drosophila_2:1637148_at:282:705; Interrogation_Position=3829; Antisense; TTAGTGCGTCTGATTCCATATCCTT
>probe:Drosophila_2:1637148_at:515:719; Interrogation_Position=3842; Antisense; TTCCATATCCTTGCCCATGTATAAT
>probe:Drosophila_2:1637148_at:589:481; Interrogation_Position=3860; Antisense; GTATAATGGTCGTCCGATGCAGCGC
>probe:Drosophila_2:1637148_at:195:301; Interrogation_Position=3885; Antisense; CCCATATTCAGACATCGCTACTTTT
>probe:Drosophila_2:1637148_at:595:335; Interrogation_Position=3985; Antisense; GCTTCAAAGTTTGTTGGACCGATCA
>probe:Drosophila_2:1637148_at:359:553; Interrogation_Position=4000; Antisense; GGACCGATCATACCAAGGACAACGA
>probe:Drosophila_2:1637148_at:536:73; Interrogation_Position=4015; Antisense; AGGACAACGATGACTATCCCAGCCT
>probe:Drosophila_2:1637148_at:359:125; Interrogation_Position=4035; Antisense; AGCCTGTTCCCACTGTACATGGGTG
>probe:Drosophila_2:1637148_at:150:139; Interrogation_Position=4131; Antisense; ACGATGATTAGCTTGACGACGAAAC
>probe:Drosophila_2:1637148_at:318:75; Interrogation_Position=4174; Antisense; AGGAGATGGACTAGCTTTAGCGTAT

Paste this into a BLAST search page for me
TAATGTTTTCTCCAATTCCTCTAGCCTCTAGCTTGTACACTTTTTTCCTGTTTTTTCCTGTAAAGCCTCTTCTGCAAAGCCTCTTCTGCTTTAGTGCGTCTTAGTGCGTCTGATTCCATATCCTTTTCCATATCCTTGCCCATGTATAATGTATAATGGTCGTCCGATGCAGCGCCCCATATTCAGACATCGCTACTTTTGCTTCAAAGTTTGTTGGACCGATCAGGACCGATCATACCAAGGACAACGAAGGACAACGATGACTATCCCAGCCTAGCCTGTTCCCACTGTACATGGGTGACGATGATTAGCTTGACGACGAAACAGGAGATGGACTAGCTTTAGCGTAT

Full Affymetrix probeset data:

Annotations for 1637148_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime