FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637150_at:

>probe:Drosophila_2:1637150_at:238:507; Interrogation_Position=2001; Antisense; GTGCGACTACCTATCACATTAAGTA
>probe:Drosophila_2:1637150_at:508:351; Interrogation_Position=2060; Antisense; GCAGACGACGGCTTATATTGTATTC
>probe:Drosophila_2:1637150_at:348:709; Interrogation_Position=2110; Antisense; TTCAAAGCTTGTTCCTGTTCCCAAA
>probe:Drosophila_2:1637150_at:523:557; Interrogation_Position=2142; Antisense; GGACATTTTGCGAACCACTGCACAG
>probe:Drosophila_2:1637150_at:392:617; Interrogation_Position=2160; Antisense; TGCACAGGACACTGGCCAGCAGCTA
>probe:Drosophila_2:1637150_at:119:115; Interrogation_Position=2177; Antisense; AGCAGCTAGACCCATTCAGATTCAG
>probe:Drosophila_2:1637150_at:619:23; Interrogation_Position=2219; Antisense; ATATGCATTTGCGTTTTCGACGGCC
>probe:Drosophila_2:1637150_at:700:577; Interrogation_Position=2269; Antisense; GGCCCGGATGGCAGTTATCACAGTT
>probe:Drosophila_2:1637150_at:35:477; Interrogation_Position=2282; Antisense; GTTATCACAGTTACCACACACGTTC
>probe:Drosophila_2:1637150_at:49:157; Interrogation_Position=2299; Antisense; ACACGTTCCACACGGACAGGACTAG
>probe:Drosophila_2:1637150_at:97:379; Interrogation_Position=2343; Antisense; GAAGCTGGGCAAATCCGTTGCAATA
>probe:Drosophila_2:1637150_at:347:695; Interrogation_Position=2417; Antisense; TTTTTTACACCGATCCGACAGCAAT
>probe:Drosophila_2:1637150_at:569:397; Interrogation_Position=2433; Antisense; GACAGCAATATTTTCCGTGGACTCC
>probe:Drosophila_2:1637150_at:606:311; Interrogation_Position=2460; Antisense; GCCAGCGATCCGAACAGAACCGTAG

Paste this into a BLAST search page for me
GTGCGACTACCTATCACATTAAGTAGCAGACGACGGCTTATATTGTATTCTTCAAAGCTTGTTCCTGTTCCCAAAGGACATTTTGCGAACCACTGCACAGTGCACAGGACACTGGCCAGCAGCTAAGCAGCTAGACCCATTCAGATTCAGATATGCATTTGCGTTTTCGACGGCCGGCCCGGATGGCAGTTATCACAGTTGTTATCACAGTTACCACACACGTTCACACGTTCCACACGGACAGGACTAGGAAGCTGGGCAAATCCGTTGCAATATTTTTTACACCGATCCGACAGCAATGACAGCAATATTTTCCGTGGACTCCGCCAGCGATCCGAACAGAACCGTAG

Full Affymetrix probeset data:

Annotations for 1637150_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720