FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637151_at:

>probe:Drosophila_2:1637151_at:354:31; Interrogation_Position=1466; Antisense; ATAAGCCTCTCAAGTTATTCCACTC
>probe:Drosophila_2:1637151_at:446:703; Interrogation_Position=1480; Antisense; TTATTCCACTCAAAGGCTCTTGCAG
>probe:Drosophila_2:1637151_at:305:445; Interrogation_Position=1506; Antisense; GATGACCTATCGACTGTTGGAGCAA
>probe:Drosophila_2:1637151_at:372:377; Interrogation_Position=1597; Antisense; GAAGCAATGCCCAACGACGAGAACA
>probe:Drosophila_2:1637151_at:347:167; Interrogation_Position=1676; Antisense; AAATGCTTGACACACAGGGCTTGAA
>probe:Drosophila_2:1637151_at:421:87; Interrogation_Position=1718; Antisense; AGTCCATGTCTGTGTTGGGTAGCGA
>probe:Drosophila_2:1637151_at:146:487; Interrogation_Position=1736; Antisense; GTAGCGAAGTGAACGTCTCCACTGC
>probe:Drosophila_2:1637151_at:56:137; Interrogation_Position=1803; Antisense; ACGAACTCGTGCAGGTGCCACAGCT
>probe:Drosophila_2:1637151_at:730:221; Interrogation_Position=1840; Antisense; AAGGGCCAGCTAGATGTGACAGTCA
>probe:Drosophila_2:1637151_at:525:677; Interrogation_Position=1866; Antisense; TAGTACGCGAACTTCCGGCAGGCAA
>probe:Drosophila_2:1637151_at:428:569; Interrogation_Position=1882; Antisense; GGCAGGCAACAAACGCTCCTTAGTA
>probe:Drosophila_2:1637151_at:457:125; Interrogation_Position=1906; Antisense; AGCCTTATGGGCTCTCGTAATACTG
>probe:Drosophila_2:1637151_at:21:29; Interrogation_Position=1925; Antisense; ATACTGCCAGCTATGTTATATCGGA
>probe:Drosophila_2:1637151_at:546:139; Interrogation_Position=1970; Antisense; TCCGGAGACCTTGTTTACCACGAAG

Paste this into a BLAST search page for me
ATAAGCCTCTCAAGTTATTCCACTCTTATTCCACTCAAAGGCTCTTGCAGGATGACCTATCGACTGTTGGAGCAAGAAGCAATGCCCAACGACGAGAACAAAATGCTTGACACACAGGGCTTGAAAGTCCATGTCTGTGTTGGGTAGCGAGTAGCGAAGTGAACGTCTCCACTGCACGAACTCGTGCAGGTGCCACAGCTAAGGGCCAGCTAGATGTGACAGTCATAGTACGCGAACTTCCGGCAGGCAAGGCAGGCAACAAACGCTCCTTAGTAAGCCTTATGGGCTCTCGTAATACTGATACTGCCAGCTATGTTATATCGGATCCGGAGACCTTGTTTACCACGAAG

Full Affymetrix probeset data:

Annotations for 1637151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720