Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637153_at:

>probe:Drosophila_2:1637153_at:117:247; Interrogation_Position=3030; Antisense; AATTCTTTGGATCTTTGCTTATGTG
>probe:Drosophila_2:1637153_at:259:341; Interrogation_Position=3046; Antisense; GCTTATGTGGAACTAGACTACGCTG
>probe:Drosophila_2:1637153_at:143:405; Interrogation_Position=3061; Antisense; GACTACGCTGAAGATGTGTAACTAC
>probe:Drosophila_2:1637153_at:505:515; Interrogation_Position=3076; Antisense; GTGTAACTACAATCATTTCGTATAA
>probe:Drosophila_2:1637153_at:681:279; Interrogation_Position=3159; Antisense; CTCTGCCGATCTCGGAGAGTTTCGA
>probe:Drosophila_2:1637153_at:719:425; Interrogation_Position=3173; Antisense; GAGAGTTTCGAAAGCATACCTTTGA
>probe:Drosophila_2:1637153_at:161:333; Interrogation_Position=3186; Antisense; GCATACCTTTGATCGGGTGTTTTGT
>probe:Drosophila_2:1637153_at:411:689; Interrogation_Position=3218; Antisense; TTTGGTTTCCAACTTGCGTTCTACA
>probe:Drosophila_2:1637153_at:453:251; Interrogation_Position=3227; Antisense; CAACTTGCGTTCTACATTCTCCAGA
>probe:Drosophila_2:1637153_at:598:11; Interrogation_Position=3242; Antisense; ATTCTCCAGACCCATTGCAAAGTTT
>probe:Drosophila_2:1637153_at:562:101; Interrogation_Position=3249; Antisense; AGACCCATTGCAAAGTTTCGACTAC
>probe:Drosophila_2:1637153_at:94:479; Interrogation_Position=3263; Antisense; GTTTCGACTACAGTGCGACGGTTGT
>probe:Drosophila_2:1637153_at:220:155; Interrogation_Position=3272; Antisense; ACAGTGCGACGGTTGTGCTGAGCTC
>probe:Drosophila_2:1637153_at:233:493; Interrogation_Position=3490; Antisense; GTAATCGCGTGATTTTTGCGGAACA

Paste this into a BLAST search page for me
AATTCTTTGGATCTTTGCTTATGTGGCTTATGTGGAACTAGACTACGCTGGACTACGCTGAAGATGTGTAACTACGTGTAACTACAATCATTTCGTATAACTCTGCCGATCTCGGAGAGTTTCGAGAGAGTTTCGAAAGCATACCTTTGAGCATACCTTTGATCGGGTGTTTTGTTTTGGTTTCCAACTTGCGTTCTACACAACTTGCGTTCTACATTCTCCAGAATTCTCCAGACCCATTGCAAAGTTTAGACCCATTGCAAAGTTTCGACTACGTTTCGACTACAGTGCGACGGTTGTACAGTGCGACGGTTGTGCTGAGCTCGTAATCGCGTGATTTTTGCGGAACA

Full Affymetrix probeset data:

Annotations for 1637153_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime