FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637154_at:

>probe:Drosophila_2:1637154_at:451:81; Interrogation_Position=2304; Antisense; AGGTGGGCATCTCCACTGCCCGGAT
>probe:Drosophila_2:1637154_at:41:611; Interrogation_Position=2364; Antisense; TGACCACCAAGTGGATCCTCGAGGG
>probe:Drosophila_2:1637154_at:96:521; Interrogation_Position=2424; Antisense; GTGGCCGCACGTGGCTGCACGAAAC
>probe:Drosophila_2:1637154_at:299:391; Interrogation_Position=2444; Antisense; GAAACCCTGCCGCTGGACTAAATAA
>probe:Drosophila_2:1637154_at:354:645; Interrogation_Position=2485; Antisense; TCTTAGATGTAGCATACCGAATCGC
>probe:Drosophila_2:1637154_at:319:235; Interrogation_Position=2504; Antisense; AATCGCGTTCCAAAGTAGAGTGCAC
>probe:Drosophila_2:1637154_at:477:433; Interrogation_Position=2521; Antisense; GAGTGCACTTTCGTCATCTTTTAGA
>probe:Drosophila_2:1637154_at:639:517; Interrogation_Position=2585; Antisense; GTGGATCCGGATCCGAATCCCAATG
>probe:Drosophila_2:1637154_at:433:251; Interrogation_Position=2626; Antisense; CAAGGATGTGCAGCTCCGATGACAG
>probe:Drosophila_2:1637154_at:108:119; Interrogation_Position=2637; Antisense; AGCTCCGATGACAGCTGCCGTCGTG
>probe:Drosophila_2:1637154_at:259:319; Interrogation_Position=2653; Antisense; GCCGTCGTGGCCACATGGGATATAT
>probe:Drosophila_2:1637154_at:405:77; Interrogation_Position=2748; Antisense; AGGTTGTTCAAACTGTCAGCCCTTG
>probe:Drosophila_2:1637154_at:393:599; Interrogation_Position=2771; Antisense; TGTCTTGGGCCCTCAAAGTTTGCAG
>probe:Drosophila_2:1637154_at:248:217; Interrogation_Position=2786; Antisense; AAGTTTGCAGCGAAAGTTCCGCGCT

Paste this into a BLAST search page for me
AGGTGGGCATCTCCACTGCCCGGATTGACCACCAAGTGGATCCTCGAGGGGTGGCCGCACGTGGCTGCACGAAACGAAACCCTGCCGCTGGACTAAATAATCTTAGATGTAGCATACCGAATCGCAATCGCGTTCCAAAGTAGAGTGCACGAGTGCACTTTCGTCATCTTTTAGAGTGGATCCGGATCCGAATCCCAATGCAAGGATGTGCAGCTCCGATGACAGAGCTCCGATGACAGCTGCCGTCGTGGCCGTCGTGGCCACATGGGATATATAGGTTGTTCAAACTGTCAGCCCTTGTGTCTTGGGCCCTCAAAGTTTGCAGAAGTTTGCAGCGAAAGTTCCGCGCT

Full Affymetrix probeset data:

Annotations for 1637154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720