FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637157_at:

>probe:Drosophila_2:1637157_at:452:141; Interrogation_Position=147; Antisense; ACGGAGTCTCAAATCTTCCACTATA
>probe:Drosophila_2:1637157_at:41:193; Interrogation_Position=204; Antisense; AACTCCTATTCCAGTTATTTCCGCA
>probe:Drosophila_2:1637157_at:327:633; Interrogation_Position=223; Antisense; TCCGCACCTACTTCTTCGAAAGAGA
>probe:Drosophila_2:1637157_at:150:203; Interrogation_Position=253; Antisense; AAGCCCAGAACTTTCAACCGTATAG
>probe:Drosophila_2:1637157_at:297:657; Interrogation_Position=285; Antisense; TAAGGATCGATTTCCCTTCATGCGC
>probe:Drosophila_2:1637157_at:244:645; Interrogation_Position=324; Antisense; TCTTGATCAGCGCTCAAAAGCTCGC
>probe:Drosophila_2:1637157_at:331:223; Interrogation_Position=406; Antisense; AAGGGTAACTACGAGGCTGCTATGA
>probe:Drosophila_2:1637157_at:637:611; Interrogation_Position=428; Antisense; TGAAAGTGTACACCGAAGCCATCGA
>probe:Drosophila_2:1637157_at:407:185; Interrogation_Position=452; Antisense; AAAATATCCGCGACAGTCACATCCT
>probe:Drosophila_2:1637157_at:700:663; Interrogation_Position=482; Antisense; TAAATCGGGCTCTTTGTTTCATCAA
>probe:Drosophila_2:1637157_at:563:501; Interrogation_Position=532; Antisense; GTCGATTGCGATTTTGTTCTGAACA
>probe:Drosophila_2:1637157_at:281:443; Interrogation_Position=585; Antisense; GATGTATCGCGCCATGGCCTACAAA
>probe:Drosophila_2:1637157_at:84:225; Interrogation_Position=608; Antisense; AAGGCCTTAACGATGAGTCCAATTT
>probe:Drosophila_2:1637157_at:604:239; Interrogation_Position=647; Antisense; AATATGCCCGCAAATTCAATTCGAA

Paste this into a BLAST search page for me
ACGGAGTCTCAAATCTTCCACTATAAACTCCTATTCCAGTTATTTCCGCATCCGCACCTACTTCTTCGAAAGAGAAAGCCCAGAACTTTCAACCGTATAGTAAGGATCGATTTCCCTTCATGCGCTCTTGATCAGCGCTCAAAAGCTCGCAAGGGTAACTACGAGGCTGCTATGATGAAAGTGTACACCGAAGCCATCGAAAAATATCCGCGACAGTCACATCCTTAAATCGGGCTCTTTGTTTCATCAAGTCGATTGCGATTTTGTTCTGAACAGATGTATCGCGCCATGGCCTACAAAAAGGCCTTAACGATGAGTCCAATTTAATATGCCCGCAAATTCAATTCGAA

Full Affymetrix probeset data:

Annotations for 1637157_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720