FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637160_at:

>probe:Drosophila_2:1637160_at:68:365; Interrogation_Position=1015; Antisense; GAATTTTGTTGGCTCTCGATGATAA
>probe:Drosophila_2:1637160_at:481:559; Interrogation_Position=511; Antisense; GGACAAGCACCCCAGTGTATTTTTG
>probe:Drosophila_2:1637160_at:325:515; Interrogation_Position=525; Antisense; GTGTATTTTTGTTCCTGCACCAGGA
>probe:Drosophila_2:1637160_at:677:653; Interrogation_Position=593; Antisense; TCAATGTGCTTTGGTGGTCCCCGAA
>probe:Drosophila_2:1637160_at:281:535; Interrogation_Position=608; Antisense; GGTCCCCGAAAGCTGATTCACATGA
>probe:Drosophila_2:1637160_at:494:247; Interrogation_Position=727; Antisense; AATTGCGCCGAATGGAGCTCGAGCC
>probe:Drosophila_2:1637160_at:154:617; Interrogation_Position=753; Antisense; TGCACACAATCTGCGATACCTACAG
>probe:Drosophila_2:1637160_at:636:27; Interrogation_Position=768; Antisense; ATACCTACAGCCCTCTGGTGGAGGA
>probe:Drosophila_2:1637160_at:193:385; Interrogation_Position=816; Antisense; GAACATTCAACACAACCGCCGTGAA
>probe:Drosophila_2:1637160_at:302:317; Interrogation_Position=833; Antisense; GCCGTGAACAACTCCGTCAATCTAG
>probe:Drosophila_2:1637160_at:648:493; Interrogation_Position=848; Antisense; GTCAATCTAGCCACGGATACTCTGT
>probe:Drosophila_2:1637160_at:362:29; Interrogation_Position=864; Antisense; ATACTCTGTACGATCTGTGGGACCA
>probe:Drosophila_2:1637160_at:521:119; Interrogation_Position=906; Antisense; AGCTGGATCCTTTAATTACTCGAGT
>probe:Drosophila_2:1637160_at:533:475; Interrogation_Position=929; Antisense; GTTACTGATCAGGTGCTCCATTTGA

Paste this into a BLAST search page for me
GAATTTTGTTGGCTCTCGATGATAAGGACAAGCACCCCAGTGTATTTTTGGTGTATTTTTGTTCCTGCACCAGGATCAATGTGCTTTGGTGGTCCCCGAAGGTCCCCGAAAGCTGATTCACATGAAATTGCGCCGAATGGAGCTCGAGCCTGCACACAATCTGCGATACCTACAGATACCTACAGCCCTCTGGTGGAGGAGAACATTCAACACAACCGCCGTGAAGCCGTGAACAACTCCGTCAATCTAGGTCAATCTAGCCACGGATACTCTGTATACTCTGTACGATCTGTGGGACCAAGCTGGATCCTTTAATTACTCGAGTGTTACTGATCAGGTGCTCCATTTGA

Full Affymetrix probeset data:

Annotations for 1637160_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720