FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637162_at:

>probe:Drosophila_2:1637162_at:88:503; Interrogation_Position=107; Antisense; GTCCGTCAACAAGAGGTCCACAGCA
>probe:Drosophila_2:1637162_at:450:535; Interrogation_Position=121; Antisense; GGTCCACAGCAATCGCTTCAGCGAA
>probe:Drosophila_2:1637162_at:520:175; Interrogation_Position=13; Antisense; AAACCTCTTACTCCTGCTCAAACAA
>probe:Drosophila_2:1637162_at:52:97; Interrogation_Position=178; Antisense; AGATCTCACCCAACTTCATTGAGCA
>probe:Drosophila_2:1637162_at:217:609; Interrogation_Position=197; Antisense; TGAGCACAAGTATTCCGCGCTGGAC
>probe:Drosophila_2:1637162_at:705:711; Interrogation_Position=234; Antisense; TTCTTCTTGAATCTGAGGGCCGGCA
>probe:Drosophila_2:1637162_at:708:287; Interrogation_Position=254; Antisense; CGGCAAAGCGGTGGCCAGTTCACAG
>probe:Drosophila_2:1637162_at:136:309; Interrogation_Position=268; Antisense; CCAGTTCACAGGGAGCCGATAGAAT
>probe:Drosophila_2:1637162_at:149:371; Interrogation_Position=289; Antisense; GAATGGGCTCACCAATGGGACACCA
>probe:Drosophila_2:1637162_at:636:593; Interrogation_Position=304; Antisense; TGGGACACCAATCGGATGTTGGCAT
>probe:Drosophila_2:1637162_at:129:443; Interrogation_Position=318; Antisense; GATGTTGGCATTTCCGGCGGATCAG
>probe:Drosophila_2:1637162_at:472:167; Interrogation_Position=379; Antisense; AAATGTGCGCGCTGCAAAACGAGCA
>probe:Drosophila_2:1637162_at:663:355; Interrogation_Position=401; Antisense; GCACATTCACCAAAATCTCTTCAAG
>probe:Drosophila_2:1637162_at:364:649; Interrogation_Position=46; Antisense; TCAGCAATCCCAACAGTAACCACGG

Paste this into a BLAST search page for me
GTCCGTCAACAAGAGGTCCACAGCAGGTCCACAGCAATCGCTTCAGCGAAAAACCTCTTACTCCTGCTCAAACAAAGATCTCACCCAACTTCATTGAGCATGAGCACAAGTATTCCGCGCTGGACTTCTTCTTGAATCTGAGGGCCGGCACGGCAAAGCGGTGGCCAGTTCACAGCCAGTTCACAGGGAGCCGATAGAATGAATGGGCTCACCAATGGGACACCATGGGACACCAATCGGATGTTGGCATGATGTTGGCATTTCCGGCGGATCAGAAATGTGCGCGCTGCAAAACGAGCAGCACATTCACCAAAATCTCTTCAAGTCAGCAATCCCAACAGTAACCACGG

Full Affymetrix probeset data:

Annotations for 1637162_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720