Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637163_at:

>probe:Drosophila_2:1637163_at:669:329; Interrogation_Position=3523; Antisense; GCGGGCCTATGAGCTTTCCAAGAAA
>probe:Drosophila_2:1637163_at:60:89; Interrogation_Position=3547; Antisense; AGTCGAAGCCATTGCTTTGCAGCGC
>probe:Drosophila_2:1637163_at:465:693; Interrogation_Position=3562; Antisense; TTTGCAGCGCAAAATTACGGCCAAG
>probe:Drosophila_2:1637163_at:196:669; Interrogation_Position=3577; Antisense; TACGGCCAAGATCGTAGCTGCCACA
>probe:Drosophila_2:1637163_at:447:679; Interrogation_Position=3680; Antisense; TAGGGTGCAGAAGCTCCAAAGTTGA
>probe:Drosophila_2:1637163_at:384:95; Interrogation_Position=3699; Antisense; AGTTGAGGCTACCAGACACCATTTC
>probe:Drosophila_2:1637163_at:269:153; Interrogation_Position=3735; Antisense; ACATGTTTACTTATGATTCGCCAAG
>probe:Drosophila_2:1637163_at:480:717; Interrogation_Position=3751; Antisense; TTCGCCAAGAGGCAGCTATGCTGGA
>probe:Drosophila_2:1637163_at:448:403; Interrogation_Position=3801; Antisense; GACTTTTTCACCATTTCAGTATGCA
>probe:Drosophila_2:1637163_at:720:239; Interrogation_Position=3855; Antisense; AATCAAAACCTGTGCCATTCTCAAC
>probe:Drosophila_2:1637163_at:130:507; Interrogation_Position=3866; Antisense; GTGCCATTCTCAACATTCTCAATTA
>probe:Drosophila_2:1637163_at:639:561; Interrogation_Position=3899; Antisense; GGAACTATTCCATTTACAGCCCAGA
>probe:Drosophila_2:1637163_at:113:247; Interrogation_Position=3934; Antisense; AATTGTTTGCCATTATTTGCCACCG
>probe:Drosophila_2:1637163_at:174:719; Interrogation_Position=3950; Antisense; TTGCCACCGTTTAATTCTTGTTTAT

Paste this into a BLAST search page for me
GCGGGCCTATGAGCTTTCCAAGAAAAGTCGAAGCCATTGCTTTGCAGCGCTTTGCAGCGCAAAATTACGGCCAAGTACGGCCAAGATCGTAGCTGCCACATAGGGTGCAGAAGCTCCAAAGTTGAAGTTGAGGCTACCAGACACCATTTCACATGTTTACTTATGATTCGCCAAGTTCGCCAAGAGGCAGCTATGCTGGAGACTTTTTCACCATTTCAGTATGCAAATCAAAACCTGTGCCATTCTCAACGTGCCATTCTCAACATTCTCAATTAGGAACTATTCCATTTACAGCCCAGAAATTGTTTGCCATTATTTGCCACCGTTGCCACCGTTTAATTCTTGTTTAT

Full Affymetrix probeset data:

Annotations for 1637163_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime