FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637164_at:

>probe:Drosophila_2:1637164_at:523:411; Interrogation_Position=459; Antisense; GACCAGGTCGACATCTTCAAGACCA
>probe:Drosophila_2:1637164_at:541:371; Interrogation_Position=500; Antisense; GAAGGACATCCTTGGCCGCTTCAAG
>probe:Drosophila_2:1637164_at:41:715; Interrogation_Position=534; Antisense; TTCTTCACCGGCGAATCTATGGACT
>probe:Drosophila_2:1637164_at:84:325; Interrogation_Position=544; Antisense; GCGAATCTATGGACTGCGACGGCAT
>probe:Drosophila_2:1637164_at:611:521; Interrogation_Position=570; Antisense; GTGGCCCTGGTGGAATACCGCGAAA
>probe:Drosophila_2:1637164_at:421:57; Interrogation_Position=621; Antisense; ATGTTCTTCAAGCACGGTCTGGAGG
>probe:Drosophila_2:1637164_at:258:395; Interrogation_Position=650; Antisense; GAAATGCTAGATGGATCCCAATCCC
>probe:Drosophila_2:1637164_at:288:141; Interrogation_Position=684; Antisense; ACGGAACCTATACTCATGCATACCT
>probe:Drosophila_2:1637164_at:399:53; Interrogation_Position=699; Antisense; ATGCATACCTTCTACACACATATAC
>probe:Drosophila_2:1637164_at:151:167; Interrogation_Position=788; Antisense; AAATGCCTGTCTTCGATCAGTGCGA
>probe:Drosophila_2:1637164_at:72:681; Interrogation_Position=818; Antisense; TATCTAATTTCTTTTTACCGGAGCG
>probe:Drosophila_2:1637164_at:105:707; Interrogation_Position=832; Antisense; TTACCGGAGCGCTTATAAATTCGAC
>probe:Drosophila_2:1637164_at:622:711; Interrogation_Position=895; Antisense; TTCAATTGCGCCACCTATTGTAATT
>probe:Drosophila_2:1637164_at:188:679; Interrogation_Position=952; Antisense; TAGTATGCATTTTCGCTAAGATATC

Paste this into a BLAST search page for me
GACCAGGTCGACATCTTCAAGACCAGAAGGACATCCTTGGCCGCTTCAAGTTCTTCACCGGCGAATCTATGGACTGCGAATCTATGGACTGCGACGGCATGTGGCCCTGGTGGAATACCGCGAAAATGTTCTTCAAGCACGGTCTGGAGGGAAATGCTAGATGGATCCCAATCCCACGGAACCTATACTCATGCATACCTATGCATACCTTCTACACACATATACAAATGCCTGTCTTCGATCAGTGCGATATCTAATTTCTTTTTACCGGAGCGTTACCGGAGCGCTTATAAATTCGACTTCAATTGCGCCACCTATTGTAATTTAGTATGCATTTTCGCTAAGATATC

Full Affymetrix probeset data:

Annotations for 1637164_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720