FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637165_at:

>probe:Drosophila_2:1637165_at:76:279; Interrogation_Position=1021; Antisense; CTACTACGACGGTGGACTGGTGGAC
>probe:Drosophila_2:1637165_at:631:141; Interrogation_Position=1036; Antisense; ACTGGTGGACAAAGACTACCGCTTT
>probe:Drosophila_2:1637165_at:226:405; Interrogation_Position=1088; Antisense; GACTCCGTGGACAACGTTTGGGACA
>probe:Drosophila_2:1637165_at:160:481; Interrogation_Position=1103; Antisense; GTTTGGGACAGAATGCGCGTAGCTT
>probe:Drosophila_2:1637165_at:687:327; Interrogation_Position=1119; Antisense; GCGTAGCTTACATGCGCTGGAAGTA
>probe:Drosophila_2:1637165_at:364:121; Interrogation_Position=1306; Antisense; AGCGAAACGATGTTGAGCCCTCTCT
>probe:Drosophila_2:1637165_at:673:467; Interrogation_Position=1341; Antisense; GTTGAATCTTGACTTCTGAACACCA
>probe:Drosophila_2:1637165_at:104:65; Interrogation_Position=782; Antisense; ATGGGCGACATCATACGCATCCACA
>probe:Drosophila_2:1637165_at:654:665; Interrogation_Position=837; Antisense; TACTTAAGTGGGAGGCGCTTCACGC
>probe:Drosophila_2:1637165_at:430:235; Interrogation_Position=875; Antisense; AATCCGCGCCTCAAGAGTTTCGGTG
>probe:Drosophila_2:1637165_at:203:521; Interrogation_Position=897; Antisense; GTGGCAAGGCCAAGGACTTCAGTCC
>probe:Drosophila_2:1637165_at:589:333; Interrogation_Position=943; Antisense; GCTGGGATACGAGCTGCCATTCGAT
>probe:Drosophila_2:1637165_at:699:405; Interrogation_Position=974; Antisense; GACTGGATAGTCGATCGCTGCGGCA
>probe:Drosophila_2:1637165_at:94:225; Interrogation_Position=998; Antisense; AAGGATGTGCGCTACGTCATCGACT

Paste this into a BLAST search page for me
CTACTACGACGGTGGACTGGTGGACACTGGTGGACAAAGACTACCGCTTTGACTCCGTGGACAACGTTTGGGACAGTTTGGGACAGAATGCGCGTAGCTTGCGTAGCTTACATGCGCTGGAAGTAAGCGAAACGATGTTGAGCCCTCTCTGTTGAATCTTGACTTCTGAACACCAATGGGCGACATCATACGCATCCACATACTTAAGTGGGAGGCGCTTCACGCAATCCGCGCCTCAAGAGTTTCGGTGGTGGCAAGGCCAAGGACTTCAGTCCGCTGGGATACGAGCTGCCATTCGATGACTGGATAGTCGATCGCTGCGGCAAAGGATGTGCGCTACGTCATCGACT

Full Affymetrix probeset data:

Annotations for 1637165_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720