FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637166_at:

>probe:Drosophila_2:1637166_at:192:303; Interrogation_Position=1022; Antisense; CCGCCTTCTTTATTTGCCGAGATAT
>probe:Drosophila_2:1637166_at:627:717; Interrogation_Position=559; Antisense; TTCGCTCCATTATCCCAGGATCAGA
>probe:Drosophila_2:1637166_at:31:545; Interrogation_Position=576; Antisense; GGATCAGATGATGCCGCGACTGGAA
>probe:Drosophila_2:1637166_at:730:645; Interrogation_Position=605; Antisense; TCATCGAAGCCGAAGCCGTTCAGAT
>probe:Drosophila_2:1637166_at:624:143; Interrogation_Position=651; Antisense; ACTGCTGACCCTGGCCAAAGGTGAT
>probe:Drosophila_2:1637166_at:692:169; Interrogation_Position=681; Antisense; AAAGGTCTTGAACGTCCTGCAGAGT
>probe:Drosophila_2:1637166_at:630:197; Interrogation_Position=739; Antisense; AACGTCTACATGTGCGTGGGCTATC
>probe:Drosophila_2:1637166_at:274:689; Interrogation_Position=788; Antisense; TATTGAAGGCCTTGCTATCCGGCAG
>probe:Drosophila_2:1637166_at:209:679; Interrogation_Position=803; Antisense; TATCCGGCAGTAGCTTGGAGGACTC
>probe:Drosophila_2:1637166_at:584:545; Interrogation_Position=819; Antisense; GGAGGACTCCTTCAAAACTGTCGAA
>probe:Drosophila_2:1637166_at:627:487; Interrogation_Position=852; Antisense; GTACGCAAGAGGTCTCGCTTTGGAA
>probe:Drosophila_2:1637166_at:338:481; Interrogation_Position=900; Antisense; GTTTGTTATGAGACTTGAGCTGCCT
>probe:Drosophila_2:1637166_at:558:609; Interrogation_Position=915; Antisense; TGAGCTGCCTATGTCGGTCATGAAC
>probe:Drosophila_2:1637166_at:715:221; Interrogation_Position=995; Antisense; AAGTGGCTCAAACTGCAGCTCTGGT

Paste this into a BLAST search page for me
CCGCCTTCTTTATTTGCCGAGATATTTCGCTCCATTATCCCAGGATCAGAGGATCAGATGATGCCGCGACTGGAATCATCGAAGCCGAAGCCGTTCAGATACTGCTGACCCTGGCCAAAGGTGATAAAGGTCTTGAACGTCCTGCAGAGTAACGTCTACATGTGCGTGGGCTATCTATTGAAGGCCTTGCTATCCGGCAGTATCCGGCAGTAGCTTGGAGGACTCGGAGGACTCCTTCAAAACTGTCGAAGTACGCAAGAGGTCTCGCTTTGGAAGTTTGTTATGAGACTTGAGCTGCCTTGAGCTGCCTATGTCGGTCATGAACAAGTGGCTCAAACTGCAGCTCTGGT

Full Affymetrix probeset data:

Annotations for 1637166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720