FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637169_at:

>probe:Drosophila_2:1637169_at:112:55; Interrogation_Position=3310; Antisense; AGCTTAGCTCTATAAACAACGGCAA
>probe:Drosophila_2:1637169_at:176:187; Interrogation_Position=3361; Antisense; AACAAACCAAGTGCTCTGATGAGGA
>probe:Drosophila_2:1637169_at:537:679; Interrogation_Position=3402; Antisense; TAGGCATGGCCGAGTTTATCTGATC
>probe:Drosophila_2:1637169_at:683:465; Interrogation_Position=3438; Antisense; GATTGGACCGGTACGGATCAGATCT
>probe:Drosophila_2:1637169_at:724:727; Interrogation_Position=3492; Antisense; TTGTGCGTGGCACCTACCAGTCTGC
>probe:Drosophila_2:1637169_at:433:129; Interrogation_Position=3507; Antisense; ACCAGTCTGCCACCTGAGAACACAT
>probe:Drosophila_2:1637169_at:46:495; Interrogation_Position=3545; Antisense; GTCACACAGCATCCTACAAAATGGT
>probe:Drosophila_2:1637169_at:662:23; Interrogation_Position=3602; Antisense; ATAGGAATCCGGTACGAAATGGTGC
>probe:Drosophila_2:1637169_at:534:39; Interrogation_Position=3636; Antisense; ATGTGGGATTCGCACGTCGAACGTT
>probe:Drosophila_2:1637169_at:250:639; Interrogation_Position=3660; Antisense; TCGTCACCGCGAACCATGTAGTTAA
>probe:Drosophila_2:1637169_at:173:203; Interrogation_Position=3683; Antisense; AACCAAGTTGTTGTATCCACTGTTG
>probe:Drosophila_2:1637169_at:85:311; Interrogation_Position=3699; Antisense; CCACTGTTGTGGGATTTCGAAAACT
>probe:Drosophila_2:1637169_at:705:689; Interrogation_Position=3743; Antisense; TTTGTTGACAACACCCGCTGGCTTT
>probe:Drosophila_2:1637169_at:641:331; Interrogation_Position=3759; Antisense; GCTGGCTTTCTTAACAACACCTTAT

Paste this into a BLAST search page for me
AGCTTAGCTCTATAAACAACGGCAAAACAAACCAAGTGCTCTGATGAGGATAGGCATGGCCGAGTTTATCTGATCGATTGGACCGGTACGGATCAGATCTTTGTGCGTGGCACCTACCAGTCTGCACCAGTCTGCCACCTGAGAACACATGTCACACAGCATCCTACAAAATGGTATAGGAATCCGGTACGAAATGGTGCATGTGGGATTCGCACGTCGAACGTTTCGTCACCGCGAACCATGTAGTTAAAACCAAGTTGTTGTATCCACTGTTGCCACTGTTGTGGGATTTCGAAAACTTTTGTTGACAACACCCGCTGGCTTTGCTGGCTTTCTTAACAACACCTTAT

Full Affymetrix probeset data:

Annotations for 1637169_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720