FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637171_at:

>probe:Drosophila_2:1637171_at:622:43; Interrogation_Position=118; Antisense; ATCGCCCATCTGAGCGACTCAAGGA
>probe:Drosophila_2:1637171_at:210:111; Interrogation_Position=130; Antisense; AGCGACTCAAGGACCAATCTCACTG
>probe:Drosophila_2:1637171_at:502:225; Interrogation_Position=138; Antisense; AAGGACCAATCTCACTGTCAACACG
>probe:Drosophila_2:1637171_at:649:261; Interrogation_Position=165; Antisense; CACCACTTGCCAGCGACTAAGGTAT
>probe:Drosophila_2:1637171_at:314:719; Interrogation_Position=171; Antisense; TTGCCAGCGACTAAGGTATGACACT
>probe:Drosophila_2:1637171_at:668:537; Interrogation_Position=185; Antisense; GGTATGACACTTTAGCAGCTCTTGG
>probe:Drosophila_2:1637171_at:305:399; Interrogation_Position=190; Antisense; GACACTTTAGCAGCTCTTGGATTTT
>probe:Drosophila_2:1637171_at:267:259; Interrogation_Position=192; Antisense; CACTTTAGCAGCTCTTGGATTTTGA
>probe:Drosophila_2:1637171_at:328:579; Interrogation_Position=27; Antisense; GGCCACAGTAAAGCCTGCCACTGGT
>probe:Drosophila_2:1637171_at:590:491; Interrogation_Position=34; Antisense; GTAAAGCCTGCCACTGGTCACACGA
>probe:Drosophila_2:1637171_at:587:537; Interrogation_Position=49; Antisense; GGTCACACGACCAAGCTCAACAATG
>probe:Drosophila_2:1637171_at:299:339; Interrogation_Position=63; Antisense; GCTCAACAATGGCAAATCCAGCAAT
>probe:Drosophila_2:1637171_at:130:189; Interrogation_Position=91; Antisense; AACAGCAACCACACATTGAGCAACT
>probe:Drosophila_2:1637171_at:642:201; Interrogation_Position=97; Antisense; AACCACACATTGAGCAACTCCATCG

Paste this into a BLAST search page for me
ATCGCCCATCTGAGCGACTCAAGGAAGCGACTCAAGGACCAATCTCACTGAAGGACCAATCTCACTGTCAACACGCACCACTTGCCAGCGACTAAGGTATTTGCCAGCGACTAAGGTATGACACTGGTATGACACTTTAGCAGCTCTTGGGACACTTTAGCAGCTCTTGGATTTTCACTTTAGCAGCTCTTGGATTTTGAGGCCACAGTAAAGCCTGCCACTGGTGTAAAGCCTGCCACTGGTCACACGAGGTCACACGACCAAGCTCAACAATGGCTCAACAATGGCAAATCCAGCAATAACAGCAACCACACATTGAGCAACTAACCACACATTGAGCAACTCCATCG

Full Affymetrix probeset data:

Annotations for 1637171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720