FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637172_at:

>probe:Drosophila_2:1637172_at:66:605; Interrogation_Position=113; Antisense; TGATTCGCGACGTAAAGCGGCGCAA
>probe:Drosophila_2:1637172_at:519:303; Interrogation_Position=155; Antisense; CCGTGGAGCGGCTGCGAGTCAACTC
>probe:Drosophila_2:1637172_at:221:431; Interrogation_Position=170; Antisense; GAGTCAACTCGCTGCGCAAGAACGA
>probe:Drosophila_2:1637172_at:188:361; Interrogation_Position=185; Antisense; GCAAGAACGACATCCTGCCGCCGGA
>probe:Drosophila_2:1637172_at:201:427; Interrogation_Position=232; Antisense; GAGATCGCTGCTTTTCCTCGGGACT
>probe:Drosophila_2:1637172_at:447:145; Interrogation_Position=254; Antisense; ACTCATCGCTCGTCCGGGTGAGGGA
>probe:Drosophila_2:1637172_at:667:607; Interrogation_Position=272; Antisense; TGAGGGAACGCTGCGCGCTTACGTC
>probe:Drosophila_2:1637172_at:452:503; Interrogation_Position=299; Antisense; GTCCGCGCGGAGTTGTCCACAAGTA
>probe:Drosophila_2:1637172_at:478:505; Interrogation_Position=313; Antisense; GTCCACAAGTACAGGCTCAGTCGAA
>probe:Drosophila_2:1637172_at:242:647; Interrogation_Position=329; Antisense; TCAGTCGAATCGTGTGGCGCCACCT
>probe:Drosophila_2:1637172_at:394:147; Interrogation_Position=359; Antisense; ACTACAATAAGCTGTCCGGCGTCCA
>probe:Drosophila_2:1637172_at:272:541; Interrogation_Position=37; Antisense; GGTTTTGTGTGCCAGTCCGTGCAAA
>probe:Drosophila_2:1637172_at:3:87; Interrogation_Position=50; Antisense; AGTCCGTGCAAATAGCCGGCTGCGG
>probe:Drosophila_2:1637172_at:489:349; Interrogation_Position=81; Antisense; GCAGGTGCGCACAAAGTATGCCGAT

Paste this into a BLAST search page for me
TGATTCGCGACGTAAAGCGGCGCAACCGTGGAGCGGCTGCGAGTCAACTCGAGTCAACTCGCTGCGCAAGAACGAGCAAGAACGACATCCTGCCGCCGGAGAGATCGCTGCTTTTCCTCGGGACTACTCATCGCTCGTCCGGGTGAGGGATGAGGGAACGCTGCGCGCTTACGTCGTCCGCGCGGAGTTGTCCACAAGTAGTCCACAAGTACAGGCTCAGTCGAATCAGTCGAATCGTGTGGCGCCACCTACTACAATAAGCTGTCCGGCGTCCAGGTTTTGTGTGCCAGTCCGTGCAAAAGTCCGTGCAAATAGCCGGCTGCGGGCAGGTGCGCACAAAGTATGCCGAT

Full Affymetrix probeset data:

Annotations for 1637172_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720