FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637173_at:

>probe:Drosophila_2:1637173_at:210:461; Interrogation_Position=186; Antisense; GATTAATCTTGAACACCAGGGCGCT
>probe:Drosophila_2:1637173_at:244:157; Interrogation_Position=198; Antisense; ACACCAGGGCGCTATTGTTTACCAC
>probe:Drosophila_2:1637173_at:129:417; Interrogation_Position=261; Antisense; GAGTACCTCTTGCAAAGTGGCTTAT
>probe:Drosophila_2:1637173_at:300:591; Interrogation_Position=307; Antisense; TTGGTCGACAAACATTGGGCTTATC
>probe:Drosophila_2:1637173_at:109:525; Interrogation_Position=323; Antisense; GGGCTTATCGTTCAGCTGATTCTAT
>probe:Drosophila_2:1637173_at:480:161; Interrogation_Position=374; Antisense; ACAATCTCGCTGTTGGTGTTTTTGA
>probe:Drosophila_2:1637173_at:609:549; Interrogation_Position=406; Antisense; GGAGAACCCCTAGCGTGGTGTCTAA
>probe:Drosophila_2:1637173_at:5:593; Interrogation_Position=421; Antisense; TGGTGTCTAAGATCTCCTCATGGTA
>probe:Drosophila_2:1637173_at:502:429; Interrogation_Position=450; Antisense; GAGTAACCTACACGTTTTATCCTCA
>probe:Drosophila_2:1637173_at:311:477; Interrogation_Position=463; Antisense; GTTTTATCCTCACATCGTCGAATGG
>probe:Drosophila_2:1637173_at:36:467; Interrogation_Position=488; Antisense; GATTGGGTTCTTTGGCAGTGCGCTT
>probe:Drosophila_2:1637173_at:45:581; Interrogation_Position=551; Antisense; TGGCCACAGTTGTTCCCGAAAACGA
>probe:Drosophila_2:1637173_at:573:559; Interrogation_Position=58; Antisense; GGAACCCCAGAAGATCTTGGCAAAT
>probe:Drosophila_2:1637173_at:638:141; Interrogation_Position=629; Antisense; ACTGGGCAGTGATACCGTGCACTTT

Paste this into a BLAST search page for me
GATTAATCTTGAACACCAGGGCGCTACACCAGGGCGCTATTGTTTACCACGAGTACCTCTTGCAAAGTGGCTTATTTGGTCGACAAACATTGGGCTTATCGGGCTTATCGTTCAGCTGATTCTATACAATCTCGCTGTTGGTGTTTTTGAGGAGAACCCCTAGCGTGGTGTCTAATGGTGTCTAAGATCTCCTCATGGTAGAGTAACCTACACGTTTTATCCTCAGTTTTATCCTCACATCGTCGAATGGGATTGGGTTCTTTGGCAGTGCGCTTTGGCCACAGTTGTTCCCGAAAACGAGGAACCCCAGAAGATCTTGGCAAATACTGGGCAGTGATACCGTGCACTTT

Full Affymetrix probeset data:

Annotations for 1637173_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720