FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637175_at:

>probe:Drosophila_2:1637175_at:151:137; Interrogation_Position=1008; Antisense; ACGTATGTAAATGCCCACGCAACCT
>probe:Drosophila_2:1637175_at:631:529; Interrogation_Position=1045; Antisense; GGGATCGCATTGAGTCACACGCTAT
>probe:Drosophila_2:1637175_at:654:201; Interrogation_Position=1155; Antisense; AACCTGGAAGCGCTCTTTGTGGTGC
>probe:Drosophila_2:1637175_at:24:593; Interrogation_Position=1174; Antisense; TGGTGCTCGCCTGCGCGAATAACAA
>probe:Drosophila_2:1637175_at:429:607; Interrogation_Position=1220; Antisense; TGAGCACCTCGATGTGGACGTCAAT
>probe:Drosophila_2:1637175_at:279:173; Interrogation_Position=1254; Antisense; AAAGCTACTGATTGGTCGGCGGACC
>probe:Drosophila_2:1637175_at:540:183; Interrogation_Position=1279; Antisense; AAAAGCGGCGTGTTGCCCTCAAGAA
>probe:Drosophila_2:1637175_at:378:305; Interrogation_Position=1295; Antisense; CCTCAAGAATTCCTTCGGCTTTGGA
>probe:Drosophila_2:1637175_at:447:301; Interrogation_Position=1333; Antisense; CCCTCTGCATTGCTAGCTACATTTA
>probe:Drosophila_2:1637175_at:233:585; Interrogation_Position=835; Antisense; TGGAAGAACTGGAGCACGCCCGCGC
>probe:Drosophila_2:1637175_at:321:529; Interrogation_Position=863; Antisense; GGGAGCTCCCATTCTAGCTGAGATT
>probe:Drosophila_2:1637175_at:600:425; Interrogation_Position=882; Antisense; GAGATTCTGGGCTACGGCTTGTCCG
>probe:Drosophila_2:1637175_at:661:725; Interrogation_Position=900; Antisense; TTGTCCGGCGATGCCTATCACATAA
>probe:Drosophila_2:1637175_at:115:555; Interrogation_Position=948; Antisense; GGAGCCACTCTTGCCATGAAGCGGG

Paste this into a BLAST search page for me
ACGTATGTAAATGCCCACGCAACCTGGGATCGCATTGAGTCACACGCTATAACCTGGAAGCGCTCTTTGTGGTGCTGGTGCTCGCCTGCGCGAATAACAATGAGCACCTCGATGTGGACGTCAATAAAGCTACTGATTGGTCGGCGGACCAAAAGCGGCGTGTTGCCCTCAAGAACCTCAAGAATTCCTTCGGCTTTGGACCCTCTGCATTGCTAGCTACATTTATGGAAGAACTGGAGCACGCCCGCGCGGGAGCTCCCATTCTAGCTGAGATTGAGATTCTGGGCTACGGCTTGTCCGTTGTCCGGCGATGCCTATCACATAAGGAGCCACTCTTGCCATGAAGCGGG

Full Affymetrix probeset data:

Annotations for 1637175_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720