FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637176_at:

>probe:Drosophila_2:1637176_at:11:211; Interrogation_Position=307; Antisense; AAGACATCGGAGCTCATGGCAGAAG
>probe:Drosophila_2:1637176_at:425:583; Interrogation_Position=323; Antisense; TGGCAGAAGTTGCTCGCAGCTATCC
>probe:Drosophila_2:1637176_at:448:421; Interrogation_Position=405; Antisense; GAGAACGCGGTTCCTACGATTTCGC
>probe:Drosophila_2:1637176_at:594:159; Interrogation_Position=440; Antisense; ACAAGTCCCTCGTAGAAGGTCGCAA
>probe:Drosophila_2:1637176_at:386:223; Interrogation_Position=455; Antisense; AAGGTCGCAAGCACAAGTTCGGCAA
>probe:Drosophila_2:1637176_at:697:81; Interrogation_Position=524; Antisense; AGGGAATGCTTATGGCCATGGGCCT
>probe:Drosophila_2:1637176_at:458:271; Interrogation_Position=555; Antisense; CATCGCTCTGATGGCCGGAAAGGCT
>probe:Drosophila_2:1637176_at:570:609; Interrogation_Position=584; Antisense; TGACAGCTTTAATGGCCTTGACCCT
>probe:Drosophila_2:1637176_at:70:285; Interrogation_Position=607; Antisense; CTGTCTGGAGTCCTCGGTCTAAAGA
>probe:Drosophila_2:1637176_at:636:525; Interrogation_Position=648; Antisense; GGGAAAGTCCACCACATACGAAATA
>probe:Drosophila_2:1637176_at:647:579; Interrogation_Position=674; Antisense; TGGCTAAACCAATTTACACCTCCAG
>probe:Drosophila_2:1637176_at:69:357; Interrogation_Position=705; Antisense; GCACTCGGTCACTCACGAAGATGGA
>probe:Drosophila_2:1637176_at:145:375; Interrogation_Position=721; Antisense; GAAGATGGAGGTCACTCCCACAGTC
>probe:Drosophila_2:1637176_at:427:669; Interrogation_Position=777; Antisense; TACTGCCAGTGGCTTTGGCTACGGA

Paste this into a BLAST search page for me
AAGACATCGGAGCTCATGGCAGAAGTGGCAGAAGTTGCTCGCAGCTATCCGAGAACGCGGTTCCTACGATTTCGCACAAGTCCCTCGTAGAAGGTCGCAAAAGGTCGCAAGCACAAGTTCGGCAAAGGGAATGCTTATGGCCATGGGCCTCATCGCTCTGATGGCCGGAAAGGCTTGACAGCTTTAATGGCCTTGACCCTCTGTCTGGAGTCCTCGGTCTAAAGAGGGAAAGTCCACCACATACGAAATATGGCTAAACCAATTTACACCTCCAGGCACTCGGTCACTCACGAAGATGGAGAAGATGGAGGTCACTCCCACAGTCTACTGCCAGTGGCTTTGGCTACGGA

Full Affymetrix probeset data:

Annotations for 1637176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720