FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637177_at:

>probe:Drosophila_2:1637177_at:663:383; Interrogation_Position=324; Antisense; GAACAGTTTCTACCAATCGCCGACG
>probe:Drosophila_2:1637177_at:318:41; Interrogation_Position=363; Antisense; ATCTGGTTGCGATCTGATGCTCCGA
>probe:Drosophila_2:1637177_at:286:315; Interrogation_Position=390; Antisense; GCCATCGAATTCCATGTACCATTTC
>probe:Drosophila_2:1637177_at:298:673; Interrogation_Position=406; Antisense; TACCATTTCAATTACCGATCGCCGG
>probe:Drosophila_2:1637177_at:529:45; Interrogation_Position=423; Antisense; ATCGCCGGGTAGTCCAATGCCTGTG
>probe:Drosophila_2:1637177_at:295:627; Interrogation_Position=440; Antisense; TGCCTGTGGCTCCAGGAGTGACCAA
>probe:Drosophila_2:1637177_at:243:193; Interrogation_Position=463; Antisense; AACTCACGAGGTCTGCATCCGTATG
>probe:Drosophila_2:1637177_at:692:655; Interrogation_Position=507; Antisense; TAATCCGCCTGGTTTCTATCCGAAT
>probe:Drosophila_2:1637177_at:687:367; Interrogation_Position=543; Antisense; GAATGCACCATACGGATCGGCAGGA
>probe:Drosophila_2:1637177_at:30:719; Interrogation_Position=594; Antisense; TTCCGGTGGCAGGTACATGGGCTAT
>probe:Drosophila_2:1637177_at:570:621; Interrogation_Position=660; Antisense; TGCGGGTCCTGGAGCAATGCAAGCT
>probe:Drosophila_2:1637177_at:180:233; Interrogation_Position=675; Antisense; AATGCAAGCTGCGTATCCTGGACAC
>probe:Drosophila_2:1637177_at:111:587; Interrogation_Position=693; Antisense; TGGACACTCGGCTCACATGCATGCG
>probe:Drosophila_2:1637177_at:264:443; Interrogation_Position=822; Antisense; GATGTTTCAGCTCTCGAATAGGTGA

Paste this into a BLAST search page for me
GAACAGTTTCTACCAATCGCCGACGATCTGGTTGCGATCTGATGCTCCGAGCCATCGAATTCCATGTACCATTTCTACCATTTCAATTACCGATCGCCGGATCGCCGGGTAGTCCAATGCCTGTGTGCCTGTGGCTCCAGGAGTGACCAAAACTCACGAGGTCTGCATCCGTATGTAATCCGCCTGGTTTCTATCCGAATGAATGCACCATACGGATCGGCAGGATTCCGGTGGCAGGTACATGGGCTATTGCGGGTCCTGGAGCAATGCAAGCTAATGCAAGCTGCGTATCCTGGACACTGGACACTCGGCTCACATGCATGCGGATGTTTCAGCTCTCGAATAGGTGA

Full Affymetrix probeset data:

Annotations for 1637177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720