FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637180_at:

>probe:Drosophila_2:1637180_at:60:577; Interrogation_Position=103; Antisense; GGCGAGCAATGAGCACACACCAATG
>probe:Drosophila_2:1637180_at:537:155; Interrogation_Position=119; Antisense; ACACCAATGCCCCAAATATTCGAGT
>probe:Drosophila_2:1637180_at:166:401; Interrogation_Position=223; Antisense; GACTTTTGCAAGGTGGAACTGGACT
>probe:Drosophila_2:1637180_at:556:381; Interrogation_Position=238; Antisense; GAACTGGACTATTTTCCCGTGTATG
>probe:Drosophila_2:1637180_at:577:601; Interrogation_Position=257; Antisense; TGTATGATCCCGACGAGCTTTCCAA
>probe:Drosophila_2:1637180_at:172:447; Interrogation_Position=286; Antisense; GATGCGAATCTTTCAAAGCCGGGCA
>probe:Drosophila_2:1637180_at:86:177; Interrogation_Position=319; Antisense; AAACGCTCATATTATTCACCGCATC
>probe:Drosophila_2:1637180_at:677:345; Interrogation_Position=339; Antisense; GCATCCTGAGGCCAGAAGGTCGAAT
>probe:Drosophila_2:1637180_at:675:163; Interrogation_Position=398; Antisense; AACTACGATATTCTCATGGCTTACA
>probe:Drosophila_2:1637180_at:462:267; Interrogation_Position=412; Antisense; CATGGCTTACAACTGCGACGGTGAG
>probe:Drosophila_2:1637180_at:47:409; Interrogation_Position=428; Antisense; GACGGTGAGCTCTCAGTCAGCAGTC
>probe:Drosophila_2:1637180_at:308:495; Interrogation_Position=443; Antisense; GTCAGCAGTCAGTCATCTCATACAA
>probe:Drosophila_2:1637180_at:437:207; Interrogation_Position=604; Antisense; AAGCTGGTATCAATGCTGCATTTCG
>probe:Drosophila_2:1637180_at:224:91; Interrogation_Position=89; Antisense; AGTATATTTACCCAGGCGAGCAATG

Paste this into a BLAST search page for me
GGCGAGCAATGAGCACACACCAATGACACCAATGCCCCAAATATTCGAGTGACTTTTGCAAGGTGGAACTGGACTGAACTGGACTATTTTCCCGTGTATGTGTATGATCCCGACGAGCTTTCCAAGATGCGAATCTTTCAAAGCCGGGCAAAACGCTCATATTATTCACCGCATCGCATCCTGAGGCCAGAAGGTCGAATAACTACGATATTCTCATGGCTTACACATGGCTTACAACTGCGACGGTGAGGACGGTGAGCTCTCAGTCAGCAGTCGTCAGCAGTCAGTCATCTCATACAAAAGCTGGTATCAATGCTGCATTTCGAGTATATTTACCCAGGCGAGCAATG

Full Affymetrix probeset data:

Annotations for 1637180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720