FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637182_at:

>probe:Drosophila_2:1637182_at:553:69; Interrogation_Position=1935; Antisense; AGGCGGTATACGTCTACCATCTATC
>probe:Drosophila_2:1637182_at:66:355; Interrogation_Position=1969; Antisense; GCACTTGCAAAATGGGCCCCTATTG
>probe:Drosophila_2:1637182_at:148:447; Interrogation_Position=2013; Antisense; GATGCCAAGCTAAGGGTCTACGGTA
>probe:Drosophila_2:1637182_at:343:533; Interrogation_Position=2027; Antisense; GGTCTACGGTATCCGAGGACTTCGC
>probe:Drosophila_2:1637182_at:5:73; Interrogation_Position=2042; Antisense; AGGACTTCGCGTCATTGATGCCAGT
>probe:Drosophila_2:1637182_at:684:605; Interrogation_Position=2057; Antisense; TGATGCCAGTATTATGCCCAAGTTG
>probe:Drosophila_2:1637182_at:268:51; Interrogation_Position=2070; Antisense; ATGCCCAAGTTGGTGTCTGCCAATA
>probe:Drosophila_2:1637182_at:287:599; Interrogation_Position=2083; Antisense; TGTCTGCCAATACGAATGCGCCGGT
>probe:Drosophila_2:1637182_at:269:51; Interrogation_Position=2098; Antisense; ATGCGCCGGTGATTATGATCGCCGA
>probe:Drosophila_2:1637182_at:102:377; Interrogation_Position=2159; Antisense; GAACACCATTGTCTGAACGAAACTT
>probe:Drosophila_2:1637182_at:490:193; Interrogation_Position=2267; Antisense; AACTGTGCTTTATCCATTGAATGTC
>probe:Drosophila_2:1637182_at:344:383; Interrogation_Position=2326; Antisense; GAACTGAGTATGATTGCCTGTGAAT
>probe:Drosophila_2:1637182_at:45:375; Interrogation_Position=2460; Antisense; GAAGTATCTTATAAGCACGCCCTTG
>probe:Drosophila_2:1637182_at:263:659; Interrogation_Position=2471; Antisense; TAAGCACGCCCTTGTATTTATTTTA

Paste this into a BLAST search page for me
AGGCGGTATACGTCTACCATCTATCGCACTTGCAAAATGGGCCCCTATTGGATGCCAAGCTAAGGGTCTACGGTAGGTCTACGGTATCCGAGGACTTCGCAGGACTTCGCGTCATTGATGCCAGTTGATGCCAGTATTATGCCCAAGTTGATGCCCAAGTTGGTGTCTGCCAATATGTCTGCCAATACGAATGCGCCGGTATGCGCCGGTGATTATGATCGCCGAGAACACCATTGTCTGAACGAAACTTAACTGTGCTTTATCCATTGAATGTCGAACTGAGTATGATTGCCTGTGAATGAAGTATCTTATAAGCACGCCCTTGTAAGCACGCCCTTGTATTTATTTTA

Full Affymetrix probeset data:

Annotations for 1637182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720