FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637187_at:

>probe:Drosophila_2:1637187_at:558:447; Interrogation_Position=2274; Antisense; GATGCCGCCCAGATGGACAAGTTGC
>probe:Drosophila_2:1637187_at:210:429; Interrogation_Position=2314; Antisense; GAGTACTCAGGAAGGAGCCCCGCTA
>probe:Drosophila_2:1637187_at:721:63; Interrogation_Position=2400; Antisense; AGGTACGGCAAAACCTACAGCCAGA
>probe:Drosophila_2:1637187_at:340:459; Interrogation_Position=2459; Antisense; GATATTCGAGCTGGTCACCATCCTC
>probe:Drosophila_2:1637187_at:333:313; Interrogation_Position=2496; Antisense; GCCAGTCCCGATCTTATGGGCATTG
>probe:Drosophila_2:1637187_at:538:449; Interrogation_Position=2520; Antisense; GATCGCCTGCCCAGATCCAAGGAGA
>probe:Drosophila_2:1637187_at:716:707; Interrogation_Position=2566; Antisense; TTAAGAATACGGCTGCCCTGGCTAA
>probe:Drosophila_2:1637187_at:208:35; Interrogation_Position=2599; Antisense; ATCACGATCAGTTGAATGCCCGCTA
>probe:Drosophila_2:1637187_at:557:49; Interrogation_Position=2614; Antisense; ATGCCCGCTACCTAAGCATCGTGAG
>probe:Drosophila_2:1637187_at:246:673; Interrogation_Position=2649; Antisense; TACGCCATGGGCAACTATCTGGTGC
>probe:Drosophila_2:1637187_at:514:563; Interrogation_Position=2689; Antisense; GGAAGACCTTTTTCGCTTACATAGC
>probe:Drosophila_2:1637187_at:316:709; Interrogation_Position=2705; Antisense; TTACATAGCTTCCAATCCGCTGGAG
>probe:Drosophila_2:1637187_at:536:235; Interrogation_Position=2718; Antisense; AATCCGCTGGAGATCATGCGTAACA
>probe:Drosophila_2:1637187_at:82:529; Interrogation_Position=2755; Antisense; GGGATTTCCGGAACTACCGCTCCAT

Paste this into a BLAST search page for me
GATGCCGCCCAGATGGACAAGTTGCGAGTACTCAGGAAGGAGCCCCGCTAAGGTACGGCAAAACCTACAGCCAGAGATATTCGAGCTGGTCACCATCCTCGCCAGTCCCGATCTTATGGGCATTGGATCGCCTGCCCAGATCCAAGGAGATTAAGAATACGGCTGCCCTGGCTAAATCACGATCAGTTGAATGCCCGCTAATGCCCGCTACCTAAGCATCGTGAGTACGCCATGGGCAACTATCTGGTGCGGAAGACCTTTTTCGCTTACATAGCTTACATAGCTTCCAATCCGCTGGAGAATCCGCTGGAGATCATGCGTAACAGGGATTTCCGGAACTACCGCTCCAT

Full Affymetrix probeset data:

Annotations for 1637187_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720