FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637189_at:

>probe:Drosophila_2:1637189_at:322:347; Interrogation_Position=2343; Antisense; GCATCCGGATTTCTCGCAAGTGAAT
>probe:Drosophila_2:1637189_at:88:435; Interrogation_Position=2371; Antisense; GAGGTGGCCCTGGAAATACTTAACA
>probe:Drosophila_2:1637189_at:99:135; Interrogation_Position=2399; Antisense; ACGCCACCAGAATCGATCCATTCGA
>probe:Drosophila_2:1637189_at:78:449; Interrogation_Position=2413; Antisense; GATCCATTCGAGATCTTCGAGCACC
>probe:Drosophila_2:1637189_at:536:625; Interrogation_Position=2450; Antisense; TGCCCATGCCCCAGCTGGAGAAATA
>probe:Drosophila_2:1637189_at:518:57; Interrogation_Position=2497; Antisense; ATGATGGCCGACAAGCACGAGATGC
>probe:Drosophila_2:1637189_at:571:621; Interrogation_Position=2530; Antisense; TGCGGCTTCCTGGAGGCAGAGTCCA
>probe:Drosophila_2:1637189_at:368:259; Interrogation_Position=2553; Antisense; CACGCGCCTGGAGAATGCCTTGGAG
>probe:Drosophila_2:1637189_at:596:431; Interrogation_Position=2608; Antisense; GAGTCTAGTGTGTGTTCCGAGTGCA
>probe:Drosophila_2:1637189_at:424:349; Interrogation_Position=2630; Antisense; GCAAGAAGCGTTTTCAAACCCAGTC
>probe:Drosophila_2:1637189_at:260:307; Interrogation_Position=2657; Antisense; CCTTCGTGCGCTATCCAAATGGGCA
>probe:Drosophila_2:1637189_at:162:169; Interrogation_Position=2673; Antisense; AAATGGGCACATCGTGCACCTATCC
>probe:Drosophila_2:1637189_at:653:307; Interrogation_Position=2714; Antisense; CCAGGGCGGCTGCTCAGCAATAAGT
>probe:Drosophila_2:1637189_at:179:657; Interrogation_Position=2817; Antisense; TAAGCTTTTTCAGTACTCGTATGTA

Paste this into a BLAST search page for me
GCATCCGGATTTCTCGCAAGTGAATGAGGTGGCCCTGGAAATACTTAACAACGCCACCAGAATCGATCCATTCGAGATCCATTCGAGATCTTCGAGCACCTGCCCATGCCCCAGCTGGAGAAATAATGATGGCCGACAAGCACGAGATGCTGCGGCTTCCTGGAGGCAGAGTCCACACGCGCCTGGAGAATGCCTTGGAGGAGTCTAGTGTGTGTTCCGAGTGCAGCAAGAAGCGTTTTCAAACCCAGTCCCTTCGTGCGCTATCCAAATGGGCAAAATGGGCACATCGTGCACCTATCCCCAGGGCGGCTGCTCAGCAATAAGTTAAGCTTTTTCAGTACTCGTATGTA

Full Affymetrix probeset data:

Annotations for 1637189_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720