FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637190_at:

>probe:Drosophila_2:1637190_at:362:373; Interrogation_Position=1036; Antisense; GAAGTGGATCTTTACGAGCTGAACG
>probe:Drosophila_2:1637190_at:30:555; Interrogation_Position=1095; Antisense; GGACCTGCAGCTGGATGCTCAGAAA
>probe:Drosophila_2:1637190_at:231:219; Interrogation_Position=1118; Antisense; AAGTAAATGTCAATGGCGGTGCCAT
>probe:Drosophila_2:1637190_at:67:467; Interrogation_Position=1158; Antisense; GATTGGAGCTTCAGGTGCCCGTGTC
>probe:Drosophila_2:1637190_at:49:515; Interrogation_Position=1178; Antisense; GTGTCTTGGTCACTTTGCTCTATGC
>probe:Drosophila_2:1637190_at:28:395; Interrogation_Position=1223; Antisense; GAAAGGGAATCGCATCGCTCTGCAT
>probe:Drosophila_2:1637190_at:240:125; Interrogation_Position=1280; Antisense; AGCGCCTCAGCTAGTCTTAATTCAT
>probe:Drosophila_2:1637190_at:77:209; Interrogation_Position=1313; Antisense; AAGCTATTTATTGCCTTTTCCTGTT
>probe:Drosophila_2:1637190_at:255:109; Interrogation_Position=1352; Antisense; AAAGTTTATTTCTCTATTCGCGTAG
>probe:Drosophila_2:1637190_at:441:7; Interrogation_Position=1367; Antisense; ATTCGCGTAGTATTCGCACGTACTT
>probe:Drosophila_2:1637190_at:520:213; Interrogation_Position=1386; Antisense; GTACTTAAAGGCACAACCTCCCAAG
>probe:Drosophila_2:1637190_at:58:293; Interrogation_Position=876; Antisense; CGTACTACTGATGTCCGGCGAGGAG
>probe:Drosophila_2:1637190_at:138:73; Interrogation_Position=907; Antisense; AGGAAGGGTCTTAAGCCGCTGGCTA
>probe:Drosophila_2:1637190_at:307:143; Interrogation_Position=978; Antisense; ACTGGGACCAGTCACAGCTGTGGAA

Paste this into a BLAST search page for me
GAAGTGGATCTTTACGAGCTGAACGGGACCTGCAGCTGGATGCTCAGAAAAAGTAAATGTCAATGGCGGTGCCATGATTGGAGCTTCAGGTGCCCGTGTCGTGTCTTGGTCACTTTGCTCTATGCGAAAGGGAATCGCATCGCTCTGCATAGCGCCTCAGCTAGTCTTAATTCATAAGCTATTTATTGCCTTTTCCTGTTAAAGTTTATTTCTCTATTCGCGTAGATTCGCGTAGTATTCGCACGTACTTGTACTTAAAGGCACAACCTCCCAAGCGTACTACTGATGTCCGGCGAGGAGAGGAAGGGTCTTAAGCCGCTGGCTAACTGGGACCAGTCACAGCTGTGGAA

Full Affymetrix probeset data:

Annotations for 1637190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720