FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637191_at:

>probe:Drosophila_2:1637191_at:200:299; Interrogation_Position=1006; Antisense; TCCTACGTGCCGCTGGTACGAAAGC
>probe:Drosophila_2:1637191_at:560:199; Interrogation_Position=1058; Antisense; AACGACAGTGGCAATTGCTGCGCCG
>probe:Drosophila_2:1637191_at:712:605; Interrogation_Position=1106; Antisense; TGATCTACGATCGTGGCACCAAGTT
>probe:Drosophila_2:1637191_at:238:215; Interrogation_Position=1126; Antisense; AAGTTCGGTCTATACACGCCTGGAG
>probe:Drosophila_2:1637191_at:258:415; Interrogation_Position=1148; Antisense; GAGCCCGGTACGAGAGCATCCTGAT
>probe:Drosophila_2:1637191_at:169:135; Interrogation_Position=1187; Antisense; ACGCCCGCTGGGAGTACATGCACGA
>probe:Drosophila_2:1637191_at:639:61; Interrogation_Position=1217; Antisense; AGTCCCAGTCCGAGGAGGGCAAACT
>probe:Drosophila_2:1637191_at:308:563; Interrogation_Position=1303; Antisense; GGAACCGGTGCCTTTTGCATTATAT
>probe:Drosophila_2:1637191_at:144:105; Interrogation_Position=809; Antisense; AGACGCTGAAGTCCGCCTGCGATGA
>probe:Drosophila_2:1637191_at:85:1; Interrogation_Position=846; Antisense; CTACTACCCGCGCTTTAAGAAGTGG
>probe:Drosophila_2:1637191_at:193:221; Interrogation_Position=865; Antisense; AAGTGGTGCGACGACTACTTCCGCA
>probe:Drosophila_2:1637191_at:338:331; Interrogation_Position=911; Antisense; GCGGCATTGGCGGAATCTTTTTCGA
>probe:Drosophila_2:1637191_at:395:701; Interrogation_Position=929; Antisense; TTTTCGACGACATCGATTCGCCCAA
>probe:Drosophila_2:1637191_at:96:713; Interrogation_Position=967; Antisense; TTCAACTTTGTGTCAAGCTGCGCCA

Paste this into a BLAST search page for me
TCCTACGTGCCGCTGGTACGAAAGCAACGACAGTGGCAATTGCTGCGCCGTGATCTACGATCGTGGCACCAAGTTAAGTTCGGTCTATACACGCCTGGAGGAGCCCGGTACGAGAGCATCCTGATACGCCCGCTGGGAGTACATGCACGAAGTCCCAGTCCGAGGAGGGCAAACTGGAACCGGTGCCTTTTGCATTATATAGACGCTGAAGTCCGCCTGCGATGACTACTACCCGCGCTTTAAGAAGTGGAAGTGGTGCGACGACTACTTCCGCAGCGGCATTGGCGGAATCTTTTTCGATTTTCGACGACATCGATTCGCCCAATTCAACTTTGTGTCAAGCTGCGCCA

Full Affymetrix probeset data:

Annotations for 1637191_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720