Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637192_at:

>probe:Drosophila_2:1637192_at:80:57; Interrogation_Position=1040; Antisense; ATGTTGTTGAACAAGCCCCTCAGCG
>probe:Drosophila_2:1637192_at:577:367; Interrogation_Position=1074; Antisense; GAACCATCCAAATGTCCGACTTTTC
>probe:Drosophila_2:1637192_at:576:431; Interrogation_Position=1129; Antisense; GAGGCCGTAGACAGTGGAGTTCCAA
>probe:Drosophila_2:1637192_at:345:429; Interrogation_Position=1145; Antisense; GAGTTCCAATGCTTGGACTACCGAT
>probe:Drosophila_2:1637192_at:241:557; Interrogation_Position=1159; Antisense; GGACTACCGATGTTTTTCGACCAAT
>probe:Drosophila_2:1637192_at:96:541; Interrogation_Position=1224; Antisense; GGTTATGGATATCAACTCTCTGAAC
>probe:Drosophila_2:1637192_at:523:633; Interrogation_Position=1321; Antisense; TCGCAATTTTTCAAGGATCGTCCCA
>probe:Drosophila_2:1637192_at:449:451; Interrogation_Position=1336; Antisense; GATCGTCCCATGAGTCCATTGGATA
>probe:Drosophila_2:1637192_at:76:485; Interrogation_Position=1370; Antisense; GGTGGACTGAGTACGCCTTACGAAA
>probe:Drosophila_2:1637192_at:65:243; Interrogation_Position=1399; Antisense; AATATTACTCGGATGCGCCTTAACT
>probe:Drosophila_2:1637192_at:379:551; Interrogation_Position=1428; Antisense; GGAGATTCCACTGATTGAGTACTAT
>probe:Drosophila_2:1637192_at:39:117; Interrogation_Position=1470; Antisense; AGCATTCAGTCTACGATTTGGATTA
>probe:Drosophila_2:1637192_at:341:459; Interrogation_Position=1484; Antisense; GATTTGGATTAGTCGCTGCATCGCT
>probe:Drosophila_2:1637192_at:274:591; Interrogation_Position=1517; Antisense; TGGTCTACACCCTGTTTCTGAAATA

Paste this into a BLAST search page for me
ATGTTGTTGAACAAGCCCCTCAGCGGAACCATCCAAATGTCCGACTTTTCGAGGCCGTAGACAGTGGAGTTCCAAGAGTTCCAATGCTTGGACTACCGATGGACTACCGATGTTTTTCGACCAATGGTTATGGATATCAACTCTCTGAACTCGCAATTTTTCAAGGATCGTCCCAGATCGTCCCATGAGTCCATTGGATAGGTGGACTGAGTACGCCTTACGAAAAATATTACTCGGATGCGCCTTAACTGGAGATTCCACTGATTGAGTACTATAGCATTCAGTCTACGATTTGGATTAGATTTGGATTAGTCGCTGCATCGCTTGGTCTACACCCTGTTTCTGAAATA

Full Affymetrix probeset data:

Annotations for 1637192_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime