Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637193_at:

>probe:Drosophila_2:1637193_at:709:207; Interrogation_Position=2713; Antisense; AAGCAGGGCAACTTCTTCCAGCGCG
>probe:Drosophila_2:1637193_at:434:255; Interrogation_Position=2739; Antisense; CAACATGGGCAATCGCGGTGACCGT
>probe:Drosophila_2:1637193_at:525:203; Interrogation_Position=2785; Antisense; AACCAGGGCGGCAATTGGCTCGGCC
>probe:Drosophila_2:1637193_at:254:329; Interrogation_Position=2814; Antisense; GCGGGATCGCAACAACCGGAACCGT
>probe:Drosophila_2:1637193_at:95:295; Interrogation_Position=2910; Antisense; CGAGGAGTAGACGTTGCTGCAACCT
>probe:Drosophila_2:1637193_at:462:47; Interrogation_Position=2941; Antisense; ATCCTCTCTAGCGAGCGTTAGCTTA
>probe:Drosophila_2:1637193_at:219:97; Interrogation_Position=2986; Antisense; AGATCAAATTTGTAGCACTTCGACT
>probe:Drosophila_2:1637193_at:402:185; Interrogation_Position=3034; Antisense; AACACGTTGGGTCACATGCTTTCAG
>probe:Drosophila_2:1637193_at:210:279; Interrogation_Position=3061; Antisense; CTCCGATTCGGTTTCAGGCTGGGTC
>probe:Drosophila_2:1637193_at:281:283; Interrogation_Position=3079; Antisense; CTGGGTCGGAGGTCTGTTTTTATCA
>probe:Drosophila_2:1637193_at:469:499; Interrogation_Position=3090; Antisense; GTCTGTTTTTATCATGTCCATTGCA
>probe:Drosophila_2:1637193_at:166:505; Interrogation_Position=3105; Antisense; GTCCATTGCATATTGTTGTAGCCAA
>probe:Drosophila_2:1637193_at:323:467; Interrogation_Position=3119; Antisense; GTTGTAGCCAAGTCACACGAACATT
>probe:Drosophila_2:1637193_at:103:191; Interrogation_Position=3138; Antisense; AACATTTGTTTCAGCGCTCATTACG

Paste this into a BLAST search page for me
AAGCAGGGCAACTTCTTCCAGCGCGCAACATGGGCAATCGCGGTGACCGTAACCAGGGCGGCAATTGGCTCGGCCGCGGGATCGCAACAACCGGAACCGTCGAGGAGTAGACGTTGCTGCAACCTATCCTCTCTAGCGAGCGTTAGCTTAAGATCAAATTTGTAGCACTTCGACTAACACGTTGGGTCACATGCTTTCAGCTCCGATTCGGTTTCAGGCTGGGTCCTGGGTCGGAGGTCTGTTTTTATCAGTCTGTTTTTATCATGTCCATTGCAGTCCATTGCATATTGTTGTAGCCAAGTTGTAGCCAAGTCACACGAACATTAACATTTGTTTCAGCGCTCATTACG

Full Affymetrix probeset data:

Annotations for 1637193_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime