Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637194_at:

>probe:Drosophila_2:1637194_at:560:499; Interrogation_Position=1062; Antisense; GTCGGCCAGTTTGCATCCGGATAAG
>probe:Drosophila_2:1637194_at:453:659; Interrogation_Position=1083; Antisense; TAAGCATGTGTTTGTTTGTGGCGGC
>probe:Drosophila_2:1637194_at:684:697; Interrogation_Position=1161; Antisense; TTTCAAGGGACATTTCGGGCCCGTG
>probe:Drosophila_2:1637194_at:399:357; Interrogation_Position=1185; Antisense; GCACAGCGTGAAGTTCAGCCCGGAT
>probe:Drosophila_2:1637194_at:153:441; Interrogation_Position=1207; Antisense; GATGGCGAACTCTATGCCAGCGGCT
>probe:Drosophila_2:1637194_at:518:103; Interrogation_Position=1274; Antisense; AGACCTACGGCTTGTGGAAGTGCAC
>probe:Drosophila_2:1637194_at:205:555; Interrogation_Position=1308; Antisense; GGACCTGGGCAATTCCATCAGCTCG
>probe:Drosophila_2:1637194_at:315:729; Interrogation_Position=1359; Antisense; TTGGCGCAGCAGGAGTCGCTGTTAC
>probe:Drosophila_2:1637194_at:189:261; Interrogation_Position=1397; Antisense; CACCGGCGACGCAACGAAAGGGCAT
>probe:Drosophila_2:1637194_at:601:347; Interrogation_Position=1418; Antisense; GCATGTGATTCGGAGCTACGGCTGA
>probe:Drosophila_2:1637194_at:256:253; Interrogation_Position=1459; Antisense; CAAGAACAACTCGTAGTGCGGGCTA
>probe:Drosophila_2:1637194_at:571:505; Interrogation_Position=1474; Antisense; GTGCGGGCTACAATAACGATTCTTC
>probe:Drosophila_2:1637194_at:655:197; Interrogation_Position=1488; Antisense; AACGATTCTTCATATTCCAACGCTG
>probe:Drosophila_2:1637194_at:77:299; Interrogation_Position=1508; Antisense; CGCTGAACTCTCTCATTGGCATTAA

Paste this into a BLAST search page for me
GTCGGCCAGTTTGCATCCGGATAAGTAAGCATGTGTTTGTTTGTGGCGGCTTTCAAGGGACATTTCGGGCCCGTGGCACAGCGTGAAGTTCAGCCCGGATGATGGCGAACTCTATGCCAGCGGCTAGACCTACGGCTTGTGGAAGTGCACGGACCTGGGCAATTCCATCAGCTCGTTGGCGCAGCAGGAGTCGCTGTTACCACCGGCGACGCAACGAAAGGGCATGCATGTGATTCGGAGCTACGGCTGACAAGAACAACTCGTAGTGCGGGCTAGTGCGGGCTACAATAACGATTCTTCAACGATTCTTCATATTCCAACGCTGCGCTGAACTCTCTCATTGGCATTAA

Full Affymetrix probeset data:

Annotations for 1637194_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime