FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637195_at:

>probe:Drosophila_2:1637195_at:574:637; Interrogation_Position=1612; Antisense; TCGTCAGTCTGCGAGTGATTGCCAT
>probe:Drosophila_2:1637195_at:500:513; Interrogation_Position=1626; Antisense; GTGATTGCCATCAAGACCATCGGTT
>probe:Drosophila_2:1637195_at:716:413; Interrogation_Position=1640; Antisense; GACCATCGGTTCGAGCATTGTGGCT
>probe:Drosophila_2:1637195_at:715:599; Interrogation_Position=1684; Antisense; TGTACTCCATCTTTGGCATCAGTGA
>probe:Drosophila_2:1637195_at:226:35; Interrogation_Position=1701; Antisense; ATCAGTGAGCCAATTGCCCAATTCA
>probe:Drosophila_2:1637195_at:67:17; Interrogation_Position=1725; Antisense; ATTTTCCCGCCAATCTTCAGTGAGA
>probe:Drosophila_2:1637195_at:339:113; Interrogation_Position=1758; Antisense; AGCACGGTGGATTCATTCCCAGGTG
>probe:Drosophila_2:1637195_at:599:505; Interrogation_Position=1780; Antisense; GTGCCATTTGGCTCTTTGGCGAAAT
>probe:Drosophila_2:1637195_at:147:583; Interrogation_Position=1796; Antisense; TGGCGAAATCTTCTACATTCCCAAT
>probe:Drosophila_2:1637195_at:593:59; Interrogation_Position=1819; Antisense; ATGTCTTGGTCTTCGTTGTGTGCTA
>probe:Drosophila_2:1637195_at:104:621; Interrogation_Position=1849; Antisense; TGCTGCGGCGTCGAAAGGCCAACGA
>probe:Drosophila_2:1637195_at:723:121; Interrogation_Position=1932; Antisense; AGCGTGGTGCCCGATAGCGAAATAA
>probe:Drosophila_2:1637195_at:642:289; Interrogation_Position=1968; Antisense; CGTACTTAATGCCAGTCCGTGTTAT
>probe:Drosophila_2:1637195_at:513:635; Interrogation_Position=2176; Antisense; TCGTTGCTATTTTTGGCCGAGTCCA

Paste this into a BLAST search page for me
TCGTCAGTCTGCGAGTGATTGCCATGTGATTGCCATCAAGACCATCGGTTGACCATCGGTTCGAGCATTGTGGCTTGTACTCCATCTTTGGCATCAGTGAATCAGTGAGCCAATTGCCCAATTCAATTTTCCCGCCAATCTTCAGTGAGAAGCACGGTGGATTCATTCCCAGGTGGTGCCATTTGGCTCTTTGGCGAAATTGGCGAAATCTTCTACATTCCCAATATGTCTTGGTCTTCGTTGTGTGCTATGCTGCGGCGTCGAAAGGCCAACGAAGCGTGGTGCCCGATAGCGAAATAACGTACTTAATGCCAGTCCGTGTTATTCGTTGCTATTTTTGGCCGAGTCCA

Full Affymetrix probeset data:

Annotations for 1637195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720