Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637197_at:

>probe:Drosophila_2:1637197_at:357:7; Interrogation_Position=3030; Antisense; ATTGCCCTTAATCTGAGTGCCATGA
>probe:Drosophila_2:1637197_at:554:363; Interrogation_Position=3068; Antisense; GAATAAACCGCTGAAACGCCTGCTC
>probe:Drosophila_2:1637197_at:167:213; Interrogation_Position=3108; Antisense; AAGAGCAATACACCGCGACAGACAT
>probe:Drosophila_2:1637197_at:598:585; Interrogation_Position=3146; Antisense; TGGAAGCCAGCTGGTGCACTTCACC
>probe:Drosophila_2:1637197_at:371:317; Interrogation_Position=3175; Antisense; GCCTGCTGACCTACGATCCGGAGGA
>probe:Drosophila_2:1637197_at:50:99; Interrogation_Position=3214; Antisense; AGAGTAGTTTCACAACGCTCGTCCA
>probe:Drosophila_2:1637197_at:413:121; Interrogation_Position=3271; Antisense; AGCGTTTACGGCGACACTGCGAGGC
>probe:Drosophila_2:1637197_at:266:71; Interrogation_Position=3292; Antisense; AGGCTGCCCTACTCGAGCGTGAAAA
>probe:Drosophila_2:1637197_at:630:545; Interrogation_Position=3353; Antisense; GGAGGCTCTGGCACGAATGGACACC
>probe:Drosophila_2:1637197_at:412:291; Interrogation_Position=3386; Antisense; CGGGATGCACACTTCGTTGGCGAGA
>probe:Drosophila_2:1637197_at:664:101; Interrogation_Position=3408; Antisense; AGAGCGGAGGCCACTGCATGTGTCA
>probe:Drosophila_2:1637197_at:67:335; Interrogation_Position=3456; Antisense; GCTGTGCGCTTTCTTATCGATTGAC
>probe:Drosophila_2:1637197_at:291:141; Interrogation_Position=3479; Antisense; ACGGAGATTAGTTCGCACCTTGGAC
>probe:Drosophila_2:1637197_at:189:53; Interrogation_Position=3513; Antisense; ATGCTGCAATGTGCTTTGTGTTGTT

Paste this into a BLAST search page for me
ATTGCCCTTAATCTGAGTGCCATGAGAATAAACCGCTGAAACGCCTGCTCAAGAGCAATACACCGCGACAGACATTGGAAGCCAGCTGGTGCACTTCACCGCCTGCTGACCTACGATCCGGAGGAAGAGTAGTTTCACAACGCTCGTCCAAGCGTTTACGGCGACACTGCGAGGCAGGCTGCCCTACTCGAGCGTGAAAAGGAGGCTCTGGCACGAATGGACACCCGGGATGCACACTTCGTTGGCGAGAAGAGCGGAGGCCACTGCATGTGTCAGCTGTGCGCTTTCTTATCGATTGACACGGAGATTAGTTCGCACCTTGGACATGCTGCAATGTGCTTTGTGTTGTT

Full Affymetrix probeset data:

Annotations for 1637197_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime