Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637198_at:

>probe:Drosophila_2:1637198_at:575:411; Interrogation_Position=1763; Antisense; GACGCCCTTCGAGAACATGATCCTG
>probe:Drosophila_2:1637198_at:363:303; Interrogation_Position=1788; Antisense; CCGCTGCTGTGGGTGGATCTGAACA
>probe:Drosophila_2:1637198_at:554:613; Interrogation_Position=1807; Antisense; TGAACATCGATGTCCTGTGCCTGAC
>probe:Drosophila_2:1637198_at:227:327; Interrogation_Position=1835; Antisense; GCGTCTGCTCATTCATGGCATCAAG
>probe:Drosophila_2:1637198_at:614:723; Interrogation_Position=1938; Antisense; TTGCTTTGCTTTTGGCCAACAGCCA
>probe:Drosophila_2:1637198_at:479:253; Interrogation_Position=1954; Antisense; CAACAGCCAGGCAGTTCCAGAAGGT
>probe:Drosophila_2:1637198_at:505:289; Interrogation_Position=2014; Antisense; TTGGAGTTGGACTCGGTTTGGCCAC
>probe:Drosophila_2:1637198_at:252:727; Interrogation_Position=2031; Antisense; TTGGCCACCGGACTTCGAAAACCAT
>probe:Drosophila_2:1637198_at:222:271; Interrogation_Position=2053; Antisense; CATCGATTCATTTGGACCCTGAGGA
>probe:Drosophila_2:1637198_at:709:573; Interrogation_Position=2100; Antisense; GGCGGCAGCTTCATTCCCAAGATGG
>probe:Drosophila_2:1637198_at:18:439; Interrogation_Position=2120; Antisense; GATGGCCAAGACGTAACCCAGCGGA
>probe:Drosophila_2:1637198_at:388:545; Interrogation_Position=2145; Antisense; GGATCGGAATGCATACCTCTAATTA
>probe:Drosophila_2:1637198_at:632:501; Interrogation_Position=2247; Antisense; GTCCTTGCCTACGTACTAGTTAACG
>probe:Drosophila_2:1637198_at:607:29; Interrogation_Position=2318; Antisense; ATACAGCTGAGCTTGCACTCGATAA

Paste this into a BLAST search page for me
GACGCCCTTCGAGAACATGATCCTGCCGCTGCTGTGGGTGGATCTGAACATGAACATCGATGTCCTGTGCCTGACGCGTCTGCTCATTCATGGCATCAAGTTGCTTTGCTTTTGGCCAACAGCCACAACAGCCAGGCAGTTCCAGAAGGTTTGGAGTTGGACTCGGTTTGGCCACTTGGCCACCGGACTTCGAAAACCATCATCGATTCATTTGGACCCTGAGGAGGCGGCAGCTTCATTCCCAAGATGGGATGGCCAAGACGTAACCCAGCGGAGGATCGGAATGCATACCTCTAATTAGTCCTTGCCTACGTACTAGTTAACGATACAGCTGAGCTTGCACTCGATAA

Full Affymetrix probeset data:

Annotations for 1637198_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime