FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637203_at:

>probe:Drosophila_2:1637203_at:604:193; Interrogation_Position=130; Antisense; AACTCGCCCATCTATGTGTCCATAT
>probe:Drosophila_2:1637203_at:138:597; Interrogation_Position=146; Antisense; TGTCCATATTTCCACCGCTTAATAA
>probe:Drosophila_2:1637203_at:267:341; Interrogation_Position=162; Antisense; GCTTAATAACTACCTGGCCGGCGTC
>probe:Drosophila_2:1637203_at:671:349; Interrogation_Position=225; Antisense; GCAGTGCCTGGAGCTAATAGTGTAT
>probe:Drosophila_2:1637203_at:724:461; Interrogation_Position=24; Antisense; GATTAAGGCCGACATCATCGTGGAG
>probe:Drosophila_2:1637203_at:695:521; Interrogation_Position=305; Antisense; GTGGCCTACCGGCAGAGGATCATTT
>probe:Drosophila_2:1637203_at:344:107; Interrogation_Position=344; Antisense; AGAACATGCGCTCTGTCATCTACAA
>probe:Drosophila_2:1637203_at:481:647; Interrogation_Position=359; Antisense; TCATCTACAAAATCTCTCAGCGCTT
>probe:Drosophila_2:1637203_at:61:627; Interrogation_Position=401; Antisense; TGCCCGCCGGAAGTTGTCAGTTTAA
>probe:Drosophila_2:1637203_at:676:615; Interrogation_Position=434; Antisense; TGCACACTACCCAGGAGGCATTCAT
>probe:Drosophila_2:1637203_at:272:427; Interrogation_Position=487; Antisense; GAGTTTCCCTGGCTTCAGACCCAAA
>probe:Drosophila_2:1637203_at:622:665; Interrogation_Position=544; Antisense; TACCTCCTTCCTTTGGCTAGGGTAG
>probe:Drosophila_2:1637203_at:601:365; Interrogation_Position=66; Antisense; GAATCACATTCTATACGTGCGCGGT
>probe:Drosophila_2:1637203_at:695:655; Interrogation_Position=92; Antisense; TATACCCCTCGCACATTTTTAAAAT

Paste this into a BLAST search page for me
AACTCGCCCATCTATGTGTCCATATTGTCCATATTTCCACCGCTTAATAAGCTTAATAACTACCTGGCCGGCGTCGCAGTGCCTGGAGCTAATAGTGTATGATTAAGGCCGACATCATCGTGGAGGTGGCCTACCGGCAGAGGATCATTTAGAACATGCGCTCTGTCATCTACAATCATCTACAAAATCTCTCAGCGCTTTGCCCGCCGGAAGTTGTCAGTTTAATGCACACTACCCAGGAGGCATTCATGAGTTTCCCTGGCTTCAGACCCAAATACCTCCTTCCTTTGGCTAGGGTAGGAATCACATTCTATACGTGCGCGGTTATACCCCTCGCACATTTTTAAAAT

Full Affymetrix probeset data:

Annotations for 1637203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720