Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637204_at:

>probe:Drosophila_2:1637204_at:686:325; Interrogation_Position=6064; Antisense; GCGACTAAACTACCTTCACACATTA
>probe:Drosophila_2:1637204_at:384:389; Interrogation_Position=6111; Antisense; GAAACAAGGCCACAGATACAACAGA
>probe:Drosophila_2:1637204_at:143:461; Interrogation_Position=6137; Antisense; GATTATCTCTAATTGACGGTGTTAT
>probe:Drosophila_2:1637204_at:614:275; Interrogation_Position=6323; Antisense; CTTAAGTATCTAAGCATGCCCACGA
>probe:Drosophila_2:1637204_at:406:267; Interrogation_Position=6337; Antisense; CATGCCCACGATTTTAGAGCTAAGC
>probe:Drosophila_2:1637204_at:274:661; Interrogation_Position=6381; Antisense; TACAAATACAAATACCCAGAGGCAG
>probe:Drosophila_2:1637204_at:104:671; Interrogation_Position=6393; Antisense; TACCCAGAGGCAGACCATAGGTTTT
>probe:Drosophila_2:1637204_at:538:381; Interrogation_Position=6421; Antisense; GAACGAACGAAGCATTTGCCCCACA
>probe:Drosophila_2:1637204_at:553:19; Interrogation_Position=6434; Antisense; ATTTGCCCCACATCCTGACAGGTTA
>probe:Drosophila_2:1637204_at:354:47; Interrogation_Position=6445; Antisense; ATCCTGACAGGTTACCGCAGCTTGT
>probe:Drosophila_2:1637204_at:626:707; Interrogation_Position=6456; Antisense; TTACCGCAGCTTGTAGAGGCCATTG
>probe:Drosophila_2:1637204_at:422:77; Interrogation_Position=6488; Antisense; AGGAGTCGCCACAGAGATCGGACAA
>probe:Drosophila_2:1637204_at:728:451; Interrogation_Position=6503; Antisense; GATCGGACAAAATCTCGCGATAAAC
>probe:Drosophila_2:1637204_at:381:59; Interrogation_Position=6558; Antisense; ATGTATGTACACCTAAGCTAATCGT

Paste this into a BLAST search page for me
GCGACTAAACTACCTTCACACATTAGAAACAAGGCCACAGATACAACAGAGATTATCTCTAATTGACGGTGTTATCTTAAGTATCTAAGCATGCCCACGACATGCCCACGATTTTAGAGCTAAGCTACAAATACAAATACCCAGAGGCAGTACCCAGAGGCAGACCATAGGTTTTGAACGAACGAAGCATTTGCCCCACAATTTGCCCCACATCCTGACAGGTTAATCCTGACAGGTTACCGCAGCTTGTTTACCGCAGCTTGTAGAGGCCATTGAGGAGTCGCCACAGAGATCGGACAAGATCGGACAAAATCTCGCGATAAACATGTATGTACACCTAAGCTAATCGT

Full Affymetrix probeset data:

Annotations for 1637204_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime