FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637205_at:

>probe:Drosophila_2:1637205_at:530:23; Interrogation_Position=1023; Antisense; ATATCCCCTGGAAATGGTGCGTCCG
>probe:Drosophila_2:1637205_at:710:137; Interrogation_Position=1079; Antisense; ACGATGGAACCATCTCTCCGAGAGA
>probe:Drosophila_2:1637205_at:439:721; Interrogation_Position=1115; Antisense; TTGCCAGCAAGTTGCCTTACGCAGT
>probe:Drosophila_2:1637205_at:566:581; Interrogation_Position=1175; Antisense; TGGACTTTCTTCTAGCTAACAACAT
>probe:Drosophila_2:1637205_at:133:559; Interrogation_Position=732; Antisense; GGACATTGAGTTGTTGCCCCATCAC
>probe:Drosophila_2:1637205_at:600:257; Interrogation_Position=754; Antisense; CACAAGATGCTGAATTCCGCGGTAT
>probe:Drosophila_2:1637205_at:653:719; Interrogation_Position=768; Antisense; TTCCGCGGTATCAGCCATATGCAAA
>probe:Drosophila_2:1637205_at:167:481; Interrogation_Position=811; Antisense; GTTTGCACTGCACTGTATCTCCTAA
>probe:Drosophila_2:1637205_at:165:557; Interrogation_Position=841; Antisense; GGACGAGTATCCCAGCACATGAACA
>probe:Drosophila_2:1637205_at:348:75; Interrogation_Position=865; Antisense; AGGACCCTCATTCCGATGTTGATTG
>probe:Drosophila_2:1637205_at:31:529; Interrogation_Position=904; Antisense; GGGATTTCTAGCAGGCAGCCGAGAC
>probe:Drosophila_2:1637205_at:663:423; Interrogation_Position=924; Antisense; GAGACACTTCTTCCAGCTCAAGGAC
>probe:Drosophila_2:1637205_at:373:289; Interrogation_Position=951; Antisense; CGGGAGATTCCGACAATACGACTTT
>probe:Drosophila_2:1637205_at:455:697; Interrogation_Position=998; Antisense; TTTACAGACAAAACACTCCACCGGA

Paste this into a BLAST search page for me
ATATCCCCTGGAAATGGTGCGTCCGACGATGGAACCATCTCTCCGAGAGATTGCCAGCAAGTTGCCTTACGCAGTTGGACTTTCTTCTAGCTAACAACATGGACATTGAGTTGTTGCCCCATCACCACAAGATGCTGAATTCCGCGGTATTTCCGCGGTATCAGCCATATGCAAAGTTTGCACTGCACTGTATCTCCTAAGGACGAGTATCCCAGCACATGAACAAGGACCCTCATTCCGATGTTGATTGGGGATTTCTAGCAGGCAGCCGAGACGAGACACTTCTTCCAGCTCAAGGACCGGGAGATTCCGACAATACGACTTTTTTACAGACAAAACACTCCACCGGA

Full Affymetrix probeset data:

Annotations for 1637205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720