Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637206_at:

>probe:Drosophila_2:1637206_at:361:665; Interrogation_Position=2572; Antisense; TACAAGCACCCAGCATTATGAATGA
>probe:Drosophila_2:1637206_at:290:325; Interrogation_Position=2652; Antisense; GCGACAGCAACGGTAGCAACATCAG
>probe:Drosophila_2:1637206_at:725:187; Interrogation_Position=2669; Antisense; AACATCAGCAGTTGCCACGTCAAAA
>probe:Drosophila_2:1637206_at:592:139; Interrogation_Position=2685; Antisense; ACGTCAAAACAATCCTCTGGGCCAG
>probe:Drosophila_2:1637206_at:648:75; Interrogation_Position=2744; Antisense; AGGAGCCGAGGCAACAGCCAGGCCA
>probe:Drosophila_2:1637206_at:246:25; Interrogation_Position=2799; Antisense; ATAGAAGGCGACAGCCCAACGTCAG
>probe:Drosophila_2:1637206_at:353:247; Interrogation_Position=2829; Antisense; AATTGCCAACTCAATGCTGGCGCAA
>probe:Drosophila_2:1637206_at:374:621; Interrogation_Position=2843; Antisense; TGCTGGCGCAAACCACAAGGCACAG
>probe:Drosophila_2:1637206_at:221:421; Interrogation_Position=2974; Antisense; GAGCAACAGCCGCAATGGGAACAGC
>probe:Drosophila_2:1637206_at:30:571; Interrogation_Position=3022; Antisense; GGCATTAGTGGCGAGCCTCCAGAAA
>probe:Drosophila_2:1637206_at:408:415; Interrogation_Position=3034; Antisense; GAGCCTCCAGAAACGTACACAACAC
>probe:Drosophila_2:1637206_at:457:255; Interrogation_Position=3053; Antisense; CAACACAAACCCAATTCCGAAATCG
>probe:Drosophila_2:1637206_at:236:387; Interrogation_Position=3083; Antisense; GAACACAAGCCCAAACCAATCGAAA
>probe:Drosophila_2:1637206_at:117:311; Interrogation_Position=3098; Antisense; CCAATCGAAATTAGCTACCCACATA

Paste this into a BLAST search page for me
TACAAGCACCCAGCATTATGAATGAGCGACAGCAACGGTAGCAACATCAGAACATCAGCAGTTGCCACGTCAAAAACGTCAAAACAATCCTCTGGGCCAGAGGAGCCGAGGCAACAGCCAGGCCAATAGAAGGCGACAGCCCAACGTCAGAATTGCCAACTCAATGCTGGCGCAATGCTGGCGCAAACCACAAGGCACAGGAGCAACAGCCGCAATGGGAACAGCGGCATTAGTGGCGAGCCTCCAGAAAGAGCCTCCAGAAACGTACACAACACCAACACAAACCCAATTCCGAAATCGGAACACAAGCCCAAACCAATCGAAACCAATCGAAATTAGCTACCCACATA

Full Affymetrix probeset data:

Annotations for 1637206_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime